Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GGT6 cdna clone

GGT6 cDNA Clone

Synonyms
GGT6; GGT6 cDNA Clone; GGT6 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcgggcagaagagcccgtggtctatcagaagctgctgccctgggagccaagcttggagtcggaggaggaagtggaggaggaggagacatcagaggcgctggttctaaacccccggaggcaccaggactcttccaggaacaaggctggcgggctgcccggaacctgggtccgtgtagtggcagccctgctgctgctggctgttggctgctccctggctgtgaggcagctccagaatcagggcaggtcgacaggaagcttgggctctgtggcccctccacccggcggacactcccacggccctggcgtataccaccacggtgccatcatcagccctgcaggccgagagctgcttgttgccgggggcaacgtcgtggatgctggagttggagctgcattgtgcctggcagtggtgcatcctcatgccacggggctaggtgccatgttttggggcctcttccacgatagctcctcaggcaattccacggccctgacatcaggcccagcacagaccctggcccccggcctggggctgcccgcggctctgcccaccctgcacctgctgcatgcacgcttcggccgcctgccctggccacgcctgctagtgggccccaccacgctggctcaggagggcttcctggtggacacacccctggcaagggctctggtggctcggggcacagaaggcctctgtccactactttgccatgctgatgggacacccctgggcgctggggcccgagccaccaacccacaactggcagctgtgcttcgcagcgcagccctcgctcccacctcagaccttgctggggatgctctactgagtctactggcgggagacctgggggtggaggtgccctcggctgtgcccaggcccactttggaaccagcagagcagctacctgtgccccagggcatcctgttcaccacccccagtccctcagctggcccagaactgctggcactgttggaggcagccctgcgctccggggcgcccatccctgacccctgcccaccgttcctgcagactgctgtgagccccgagagcagtgccctggccgccgtggacagcagcggctctgtgctccttctcacctcctcgctcaactgctcctttggctctgcacacctgtccccaagcactggggttctgctcagcaacctggtggccaagtctaccactagtgcctgggcctgccccctcatcctccgtggcagcctggatgacacagaggctgatgtgttggggcttgtggcttcagggacccctgatgtggccagggccatgactcacaccctactcaggcatctggcagcaaggccccctacccaggcccagcaccagcatcagggtcagcaagaaccaacagagcatcccagcacttgtggccaagggaccctgctccaggtggcagcccacacagagcacgcccatgtctccagtgtcccccatgcctgctgccccttccaggggttctaa
Sequence Length
1482
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,490 Da
NCBI Official Full Name
Homo sapiens gamma-glutamyltransferase 6, mRNA
NCBI Official Synonym Full Names
gamma-glutamyltransferase 6
NCBI Official Symbol
GGT6
NCBI Protein Information
gamma-glutamyltransferase 6
UniProt Protein Name
Gamma-glutamyltransferase 6
Protein Family
UniProt Gene Name
GGT6
UniProt Synonym Gene Names
GGT 6
UniProt Entry Name
GGT6_HUMAN

NCBI Description

GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]

Uniprot Description

GGT6: Cleaves glutathione conjugates. Belongs to the gamma-glutamyltransferase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Other Amino Acids Metabolism - taurine and hypotaurine; Other Amino Acids Metabolism - cyanoamino acid; Membrane protein, integral; Other Amino Acids Metabolism - glutathione; EC 3.4.19.13; Other Amino Acids Metabolism - selenoamino acid; EC 2.3.2.2; Transferase; Lipid Metabolism - arachidonic acid

Chromosomal Location of Human Ortholog: 17p13.2

Cellular Component: anchored to external side of plasma membrane

Molecular Function: gamma-glutamyltransferase activity

Biological Process: glutathione metabolic process; leukotriene biosynthetic process

Similar Products

Product Notes

The GGT6 ggt6 (Catalog #AAA1275302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcggg cagaagagcc cgtggtctat cagaagctgc tgccctggga gccaagcttg gagtcggagg aggaagtgga ggaggaggag acatcagagg cgctggttct aaacccccgg aggcaccagg actcttccag gaacaaggct ggcgggctgc ccggaacctg ggtccgtgta gtggcagccc tgctgctgct ggctgttggc tgctccctgg ctgtgaggca gctccagaat cagggcaggt cgacaggaag cttgggctct gtggcccctc cacccggcgg acactcccac ggccctggcg tataccacca cggtgccatc atcagccctg caggccgaga gctgcttgtt gccgggggca acgtcgtgga tgctggagtt ggagctgcat tgtgcctggc agtggtgcat cctcatgcca cggggctagg tgccatgttt tggggcctct tccacgatag ctcctcaggc aattccacgg ccctgacatc aggcccagca cagaccctgg cccccggcct ggggctgccc gcggctctgc ccaccctgca cctgctgcat gcacgcttcg gccgcctgcc ctggccacgc ctgctagtgg gccccaccac gctggctcag gagggcttcc tggtggacac acccctggca agggctctgg tggctcgggg cacagaaggc ctctgtccac tactttgcca tgctgatggg acacccctgg gcgctggggc ccgagccacc aacccacaac tggcagctgt gcttcgcagc gcagccctcg ctcccacctc agaccttgct ggggatgctc tactgagtct actggcggga gacctggggg tggaggtgcc ctcggctgtg cccaggccca ctttggaacc agcagagcag ctacctgtgc cccagggcat cctgttcacc acccccagtc cctcagctgg cccagaactg ctggcactgt tggaggcagc cctgcgctcc ggggcgccca tccctgaccc ctgcccaccg ttcctgcaga ctgctgtgag ccccgagagc agtgccctgg ccgccgtgga cagcagcggc tctgtgctcc ttctcacctc ctcgctcaac tgctcctttg gctctgcaca cctgtcccca agcactgggg ttctgctcag caacctggtg gccaagtcta ccactagtgc ctgggcctgc cccctcatcc tccgtggcag cctggatgac acagaggctg atgtgttggg gcttgtggct tcagggaccc ctgatgtggc cagggccatg actcacaccc tactcaggca tctggcagca aggcccccta cccaggccca gcaccagcat cagggtcagc aagaaccaac agagcatccc agcacttgtg gccaagggac cctgctccag gtggcagccc acacagagca cgcccatgtc tccagtgtcc cccatgcctg ctgccccttc caggggttct aa. It is sometimes possible for the material contained within the vial of "GGT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.