Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NKAP cdna clone

NKAP cDNA Clone

Synonyms
NKAP; NKAP cDNA Clone; NKAP cdna clone
Ordering
For Research Use Only!
Sequence
atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatcagctgggtggcctcagccaaggctcccgaaaccagtcctaccgctcacgctcgcggtcgcgttctagagagcggccctctgcgccccggggcatccccttcgcttctgcctcctcgtcagtctattacggcagctactcgcgcccctacgggagcgacaagccttggcctagcctcctcgacaaggagagggaggagagcctgcggcagaagagattaagtgagagagagagaattggagaattgggagctcctgaagtatggggactttctccaaagaatcctgaaccagattctgatgaacatacaccagtggaggatgaagagccaaagaaaagcactacttcagcttctacttcagaagaagaaaaaaagaagaagtctagccgttcaaaagaaaggtccaagaaaaggagaaagaaaaaatcatcgaaaagaaaacataagaagtattctgaagatagcgacagtgactctgattctgaaacagactccagtgatgaagataacaaaaggagagcaaagaaagccaagaaaaaggaaaagaagaagaaacacagatcgaagaaatataagaaaaagaggtctaagaagagcagaaaagagtccagtgattcaagctctaaagaatcccaagaagagtttctggaaaatccctggaagtatcgaacaaaggctgaagaaccatcagatttaattggcccagaggctccaaaaacacttacctctcaagatgataaacctttgaactatggccatgctctgttacctggtgaaggtgcagctatggctgaatatgtaaaagctggaaaacgtatcccacgaagaggtgaaattggcttgacaagtgaagaaattgcatcatttgaatgctcaggttatgtaatgagtggtagcaggcatcgccgaatggaggctgtgcgactgcgaaaagagaaccagatctacagtgctgatgagaagagagcccttgcatcctttaaccaagaagagagacgaaagagagagaacaagattctggccagttttcgagaaatggtttacagaaagaccaaagggaaggatgacaaataa
Sequence Length
1248
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,138 Da
NCBI Official Full Name
Homo sapiens NFKB activating protein, mRNA
NCBI Official Synonym Full Names
NFKB activating protein
NCBI Official Symbol
NKAP
NCBI Protein Information
NF-kappa-B-activating protein
UniProt Protein Name
NF-kappa-B-activating protein
Protein Family
UniProt Gene Name
NKAP
UniProt Entry Name
NKAP_HUMAN

NCBI Description

This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6. [provided by RefSeq, May 2010]

Uniprot Description

NKAP: Acts as a transcriptional repressor. Plays a role as a transcriptional corepressor of the Notch-mediated signaling required for T-cell development. Also involved in the TNF and IL-1 induced NF-kappa-B activation. Associates with chromatin at the Notch-regulated SKP2 promoter. Belongs to the UPF0396 family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: Xq24

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: chromatin binding; protein binding

Biological Process: negative regulation of transcription, DNA-dependent; positive regulation of alpha-beta T cell differentiation

Research Articles on NKAP

Similar Products

Product Notes

The NKAP nkap (Catalog #AAA1275258) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccgg tgtccggctc acgcagcccg gatagggagg cctcgggctc ggggggaaga cgtcgcagtt cgtcgaagag tccgaagccc agcaaatctg cccgctcccc gcggggccgc cgctctcgct cgcactcttg ctctcggtcc ggggaccgga atggactcac ccatcagctg ggtggcctca gccaaggctc ccgaaaccag tcctaccgct cacgctcgcg gtcgcgttct agagagcggc cctctgcgcc ccggggcatc cccttcgctt ctgcctcctc gtcagtctat tacggcagct actcgcgccc ctacgggagc gacaagcctt ggcctagcct cctcgacaag gagagggagg agagcctgcg gcagaagaga ttaagtgaga gagagagaat tggagaattg ggagctcctg aagtatgggg actttctcca aagaatcctg aaccagattc tgatgaacat acaccagtgg aggatgaaga gccaaagaaa agcactactt cagcttctac ttcagaagaa gaaaaaaaga agaagtctag ccgttcaaaa gaaaggtcca agaaaaggag aaagaaaaaa tcatcgaaaa gaaaacataa gaagtattct gaagatagcg acagtgactc tgattctgaa acagactcca gtgatgaaga taacaaaagg agagcaaaga aagccaagaa aaaggaaaag aagaagaaac acagatcgaa gaaatataag aaaaagaggt ctaagaagag cagaaaagag tccagtgatt caagctctaa agaatcccaa gaagagtttc tggaaaatcc ctggaagtat cgaacaaagg ctgaagaacc atcagattta attggcccag aggctccaaa aacacttacc tctcaagatg ataaaccttt gaactatggc catgctctgt tacctggtga aggtgcagct atggctgaat atgtaaaagc tggaaaacgt atcccacgaa gaggtgaaat tggcttgaca agtgaagaaa ttgcatcatt tgaatgctca ggttatgtaa tgagtggtag caggcatcgc cgaatggagg ctgtgcgact gcgaaaagag aaccagatct acagtgctga tgagaagaga gcccttgcat cctttaacca agaagagaga cgaaagagag agaacaagat tctggccagt tttcgagaaa tggtttacag aaagaccaaa gggaaggatg acaaataa. It is sometimes possible for the material contained within the vial of "NKAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.