Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NEDD4L cdna clone

NEDD4L cDNA Clone

Gene Names
NEDD4L; RSP5; NEDD4-2; NEDD4.2; hNEDD4-2
Synonyms
NEDD4L; NEDD4L cDNA Clone; NEDD4L cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaccgggctcggggagccggtctatggactttccgaagacgagggagagtcccgtattctcagagtaaaagttgtttctggaattgatctcgccaaaaaggacatctttggagccagtgatccgtatgtgaaactttcattgtacgtagcggatgagaatagagaacttgctttggtccagacaaaaacaattaaaaagacactgaacccaaaatggaatgaagaattttatttcagggtaaacccatctaatcacagactcctatttgaagtatttgacgaaaatagactgacacgagacgacttcctgggccaggtggacgtgccccttagtcaccttccgacagaagatccaaccatggagcgaccctatacatttaaggactttctcctcagaccaagaagtcataagtctcgagttaagggatttttgcgattgaaaatggcctatatgccaaaaaatggaggtcaagatgaagaaaacagtgaccagagggatgacatggagcatggatgggaagttgttgactcaaatgactcggcttctcagcaccaagaggaacttcctcctcctcctctgcctcccgggtgggaagaaaaagtggacaatttaggccgaacttactatgtcaaccacaacaaccggaccactcagtggcacagaccaagcctgatggacgtgtcctcggagtcggacaataacatcagacagatcaaccaggaggcagcacaccggcgcttccgctcccgcaggcacatcagcgaagacttggagcccgagccctcggagggcggggatgtccccgagccttgggagaccatttcagaggaagtgaatatcgctggagactctctcggtctggctctgcccccaccaccggcctccccaggatctcggaccagccctcaggagctgtcagaggaactaagcagaaggcttcagatcactccagactccaatggggaacagttcagctctttgattcaaagagaaccctcctcaaggttgaggtcatgcagtgtcaccgacgcagttgcagaacagggccatctaccaccgcttgcagaagatggtgcgtccggatcagccacaaacagtaacaaccatctaatcgagcctcagatccgccggcctcgtagcctcagctcgccaacagtaactttatctgccccgctggagggtgccaaggactcacccgtacgtcgggctgtgaaagacaccctttccaacccacagtccccacagccatcaccttacaactcccccaaaccacaacacaaagtcacacagagcttcttgccacccggctgggaaatgaggatagcgccaaacggccggcccttcttcattgatcataacacaaagactacaacctgggaagatccacgtttgaaatttccagtacatatgcggtcaaagacatctttaaaccccaatgaccttggcccccttcctcctggctgggaagaaagaattcacttggatggccgaacgttttatattgatcataatagcaaaattactcagtgggaagacccaagactgcagaacccagctattactggtccggctgtcccttactccagagaatttaagcagaaatatgactacttcaggaagaaattaaagaaacctgctgatatccccaataggtttgaaatgaaacttcacagaaataacatatttgaagagtcctatcggagaattatgtccgtgaaaagaccagatgtcctaaaagctagactgtggattgagtttgaatcagagaaaggtcttgactatgggggtgtggccagagaatggttcttcttactgtccaaagagatgttcaacccctactacggcctctttgagtactctgccacggacaactacacccttcagatcaaccctaattcaggcctctgtaatgaggatcatttgtcctacttcacttttattggaagagttgctggtctggccgtatttcatgggaagctcttagatggtttcttcattagaccattttacaagatgatgttgggaaagcagataaccctgaatgacatggaatctgtggatagtgaatattacaactctttgaaatggatcctggagaatgaccctactgagctggacctcatgttctgcatagacgaagaaaactttggacagacatatcaagtggatttgaagcccaatgggtcagaaataatggtcacaaatgaaaacaaaagggaatatatcgacttagtcatccagtggagatttgtgaacagggtccagaagcagatgaacgccttcttggagggattcacagaactacttcctattgatttgattaaaatttttgatgaaaatgagctggagttgctcatgtgcggcctcggtgatgtggatgtgaatgactggagacagcattctatttacaagaacggctactgcccaaaccaccccgtcattcagtggttctggaaggctgtgctactcatggacgccgaaaagcgtatccggttactgcagtttgtcacagggacatcgcgagtacctatgaatggatttgccgaactttatggttccaatggtcctcagctgtttacaatagagcaatggggcagtcctgagaaactgcccagagctcacacatgctttaatcgccttgacttacctccatatgaaacctttgaagatttacgagagaaacttctcatggccgtggaaaatgctcaaggatttgaaggggtggattaa
Sequence Length
2736
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
96,271 Da
NCBI Official Full Name
Homo sapiens neural cell expressed, developmentally down-regulated 4-like, mRNA
NCBI Official Synonym Full Names
neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase
NCBI Official Symbol
NEDD4L
NCBI Official Synonym Symbols
RSP5; NEDD4-2; NEDD4.2; hNEDD4-2
NCBI Protein Information
E3 ubiquitin-protein ligase NEDD4-like
UniProt Protein Name
E3 ubiquitin-protein ligase NEDD4-like
UniProt Gene Name
NEDD4L
UniProt Synonym Gene Names
KIAA0439; NEDL3
UniProt Entry Name
NED4L_HUMAN

NCBI Description

This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]

Uniprot Description

NEDD4L: E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Inhibits TGF-beta signaling by triggering SMAD2 and TGFBR1 ubiquitination and proteasome-dependent degradation. Promotes ubiquitination and internalization of various plasma membrane channels such as ENaC, Nav1.2, Nav1.3, Nav1.5, Nav1.7, Nav1.8, Kv1.3, EAAT1 or CLC5. Promotes ubiquitination and degradation of SGK1 and TNK2. Interacts with UBE2E3. Interacts with NDFIP1 and NDFIP2; this interaction activates the E3 ubiquitin-protein ligase. Interacts via its WW domains with SCNN1A, SCNN1B, SCNN1G, SCN1A, SCN2A, SCN3A, SCN5A, SCN8A, SCN9A, SCN10A and CLCN5. Interacts with SMAD2, SMAD3, SMAD6 and SMAD7. The phosphorylated form interacts with 14-3-3 proteins. Interacts with Epstein-Barr virus LMP2A. Interacts with TNK2. Interacts with WNK1. Interacts with SGK1. By androgens in prostate, and by albumin in kidney. Ubiquitously expressed, with highest levels in prostate, pancreas and kidney. Activated by NDFIP1- and NDFIP2-binding. 9 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ubiquitin conjugating system; Ligase; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 18q21.31

Cellular Component: cytoplasm; cytosol; intracellular; nucleoplasm; nucleus; plasma membrane

Molecular Function: potassium channel inhibitor activity; potassium channel regulator activity; protein binding; sodium channel inhibitor activity; sodium channel regulator activity; ubiquitin-protein ligase activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of membrane potential; response to metal ion; viral infectious cycle

Research Articles on NEDD4L

Similar Products

Product Notes

The NEDD4L nedd4l (Catalog #AAA1275240) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccg ggctcgggga gccggtctat ggactttccg aagacgaggg agagtcccgt attctcagag taaaagttgt ttctggaatt gatctcgcca aaaaggacat ctttggagcc agtgatccgt atgtgaaact ttcattgtac gtagcggatg agaatagaga acttgctttg gtccagacaa aaacaattaa aaagacactg aacccaaaat ggaatgaaga attttatttc agggtaaacc catctaatca cagactccta tttgaagtat ttgacgaaaa tagactgaca cgagacgact tcctgggcca ggtggacgtg ccccttagtc accttccgac agaagatcca accatggagc gaccctatac atttaaggac tttctcctca gaccaagaag tcataagtct cgagttaagg gatttttgcg attgaaaatg gcctatatgc caaaaaatgg aggtcaagat gaagaaaaca gtgaccagag ggatgacatg gagcatggat gggaagttgt tgactcaaat gactcggctt ctcagcacca agaggaactt cctcctcctc ctctgcctcc cgggtgggaa gaaaaagtgg acaatttagg ccgaacttac tatgtcaacc acaacaaccg gaccactcag tggcacagac caagcctgat ggacgtgtcc tcggagtcgg acaataacat cagacagatc aaccaggagg cagcacaccg gcgcttccgc tcccgcaggc acatcagcga agacttggag cccgagccct cggagggcgg ggatgtcccc gagccttggg agaccatttc agaggaagtg aatatcgctg gagactctct cggtctggct ctgcccccac caccggcctc cccaggatct cggaccagcc ctcaggagct gtcagaggaa ctaagcagaa ggcttcagat cactccagac tccaatgggg aacagttcag ctctttgatt caaagagaac cctcctcaag gttgaggtca tgcagtgtca ccgacgcagt tgcagaacag ggccatctac caccgcttgc agaagatggt gcgtccggat cagccacaaa cagtaacaac catctaatcg agcctcagat ccgccggcct cgtagcctca gctcgccaac agtaacttta tctgccccgc tggagggtgc caaggactca cccgtacgtc gggctgtgaa agacaccctt tccaacccac agtccccaca gccatcacct tacaactccc ccaaaccaca acacaaagtc acacagagct tcttgccacc cggctgggaa atgaggatag cgccaaacgg ccggcccttc ttcattgatc ataacacaaa gactacaacc tgggaagatc cacgtttgaa atttccagta catatgcggt caaagacatc tttaaacccc aatgaccttg gcccccttcc tcctggctgg gaagaaagaa ttcacttgga tggccgaacg ttttatattg atcataatag caaaattact cagtgggaag acccaagact gcagaaccca gctattactg gtccggctgt cccttactcc agagaattta agcagaaata tgactacttc aggaagaaat taaagaaacc tgctgatatc cccaataggt ttgaaatgaa acttcacaga aataacatat ttgaagagtc ctatcggaga attatgtccg tgaaaagacc agatgtccta aaagctagac tgtggattga gtttgaatca gagaaaggtc ttgactatgg gggtgtggcc agagaatggt tcttcttact gtccaaagag atgttcaacc cctactacgg cctctttgag tactctgcca cggacaacta cacccttcag atcaacccta attcaggcct ctgtaatgag gatcatttgt cctacttcac ttttattgga agagttgctg gtctggccgt atttcatggg aagctcttag atggtttctt cattagacca ttttacaaga tgatgttggg aaagcagata accctgaatg acatggaatc tgtggatagt gaatattaca actctttgaa atggatcctg gagaatgacc ctactgagct ggacctcatg ttctgcatag acgaagaaaa ctttggacag acatatcaag tggatttgaa gcccaatggg tcagaaataa tggtcacaaa tgaaaacaaa agggaatata tcgacttagt catccagtgg agatttgtga acagggtcca gaagcagatg aacgccttct tggagggatt cacagaacta cttcctattg atttgattaa aatttttgat gaaaatgagc tggagttgct catgtgcggc ctcggtgatg tggatgtgaa tgactggaga cagcattcta tttacaagaa cggctactgc ccaaaccacc ccgtcattca gtggttctgg aaggctgtgc tactcatgga cgccgaaaag cgtatccggt tactgcagtt tgtcacaggg acatcgcgag tacctatgaa tggatttgcc gaactttatg gttccaatgg tcctcagctg tttacaatag agcaatgggg cagtcctgag aaactgccca gagctcacac atgctttaat cgccttgact tacctccata tgaaaccttt gaagatttac gagagaaact tctcatggcc gtggaaaatg ctcaaggatt tgaaggggtg gattaa. It is sometimes possible for the material contained within the vial of "NEDD4L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.