Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERCC1 cdna clone

ERCC1 cDNA Clone

Gene Names
ERCC1; UV20; COFS4; RAD10
Synonyms
ERCC1; ERCC1 cDNA Clone; ERCC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaccctgggaaggacaaagagggggtgccccagccctcagggccgccagcaaggaagaaatttgtgatacccctcgacgaggatgaggtccctcctggagtggccaagcccttattccgatctacacagagccttcccactgtggacacctcggcccaggcggcccctcagacctacgccgaatatgccatctcacagcctctggaaggggctggggccacgtgccccacagggtcagagcccctggcaggagagacgcccaaccaggccctgaaacccggggcaaaatccaacagcatcattgtgagccctcggcagaggggcaatcccgtactgaagttcgtgcgcaacgtgccctgggaatttggcgacgtaattcccgactatgtgctgggccagagcacctgtgccctgttcctcagcctccgctaccacaacctgcacccagactacatccatgggcggctgcagagcctggggaagaacttcgccttgcgggtcctgcttgtccaggtggatgtgaaagatccccagcaggccctcaaggagctggctaagatgtgtatcctggccgactgcacattgatcctcgcctggagccccgaggaagctgggcggtacctggagacctacaaggcctatgagcagaaaccagcggacctcctgatggagaagctagagcaggacttcgtctcccgggtgactgaatgtctgaccaccgtgaagtcagtcaacaaaacggacagtcagaccctcctgaccacatttggatctctggaacagctcatcgccgcatcaagagaagatctggccttatgcccaggcctgggccctcagaaagcccggaggctgtttgatgtcctgcacgagcccttcttgaaagtaccctga
Sequence Length
894
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,211 Da
NCBI Official Full Name
Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence), mRNA
NCBI Official Synonym Full Names
ERCC excision repair 1, endonuclease non-catalytic subunit
NCBI Official Symbol
ERCC1
NCBI Official Synonym Symbols
UV20; COFS4; RAD10
NCBI Protein Information
DNA excision repair protein ERCC-1
UniProt Protein Name
DNA excision repair protein ERCC-1
UniProt Gene Name
ERCC1
UniProt Entry Name
ERCC1_HUMAN

NCBI Description

The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]

Uniprot Description

ERCC1: a structure-specific DNA repair endonuclease responsible for the 5'-incision during DNA excision repair. Belongs to the ERCC1/RAD10/SWI10 family. Heterodimer composed of ERCC1 and XPF/ERRC4. Defects in ERCC1 are the cause of cerebro-oculo-facio-skeletal syndrome type 4, a degenerative autosomal recessive disorder of prenatal onset affecting the brain, eye and spinal cord. After birth, it leads to brain atrophy, hypoplasia of the corpus callosum, hypotonia, cataracts, microcornea, optic atrophy, progressive joint contractures and growth failure. Facial dysmorphism is a constant feature. Abnormalities of the skull, eyes, limbs, heart and kidney also occur. Low levels of this protein are associated with increased sensitivity to cisplatin. The overall survival of non-small cell lung cancer patients with single-nucleotide polymorphisms at codon 118 receiving platinum-based chemotherapy was significantly improved.

Protein type: DNA repair, damage

Chromosomal Location of Human Ortholog: 19q13.32

Cellular Component: cytoplasm; nuclear chromosome, telomeric region; nucleoplasm; nucleotide-excision repair complex

Molecular Function: damaged DNA binding; protein binding; protein C-terminus binding; protein domain specific binding; single-stranded DNA binding; single-stranded DNA specific endodeoxyribonuclease activity; structure-specific DNA binding

Biological Process: DNA recombination; DNA repair; meiotic mismatch repair; mitotic recombination; negative regulation of telomere maintenance; nucleotide-excision repair; nucleotide-excision repair, DNA incision; nucleotide-excision repair, DNA incision, 3'-to lesion; nucleotide-excision repair, DNA incision, 5'-to lesion; nucleotide-excision repair, preincision complex stabilization; response to oxidative stress; transcription-coupled nucleotide-excision repair

Disease: Cerebrooculofacioskeletal Syndrome 4

Research Articles on ERCC1

Similar Products

Product Notes

The ERCC1 ercc1 (Catalog #AAA1275225) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccctg ggaaggacaa agagggggtg ccccagccct cagggccgcc agcaaggaag aaatttgtga tacccctcga cgaggatgag gtccctcctg gagtggccaa gcccttattc cgatctacac agagccttcc cactgtggac acctcggccc aggcggcccc tcagacctac gccgaatatg ccatctcaca gcctctggaa ggggctgggg ccacgtgccc cacagggtca gagcccctgg caggagagac gcccaaccag gccctgaaac ccggggcaaa atccaacagc atcattgtga gccctcggca gaggggcaat cccgtactga agttcgtgcg caacgtgccc tgggaatttg gcgacgtaat tcccgactat gtgctgggcc agagcacctg tgccctgttc ctcagcctcc gctaccacaa cctgcaccca gactacatcc atgggcggct gcagagcctg gggaagaact tcgccttgcg ggtcctgctt gtccaggtgg atgtgaaaga tccccagcag gccctcaagg agctggctaa gatgtgtatc ctggccgact gcacattgat cctcgcctgg agccccgagg aagctgggcg gtacctggag acctacaagg cctatgagca gaaaccagcg gacctcctga tggagaagct agagcaggac ttcgtctccc gggtgactga atgtctgacc accgtgaagt cagtcaacaa aacggacagt cagaccctcc tgaccacatt tggatctctg gaacagctca tcgccgcatc aagagaagat ctggccttat gcccaggcct gggccctcag aaagcccgga ggctgtttga tgtcctgcac gagcccttct tgaaagtacc ctga. It is sometimes possible for the material contained within the vial of "ERCC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.