Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FTL cdna clone

FTL cDNA Clone

Gene Names
FTL; LFTD; NBIA3
Synonyms
FTL; FTL cDNA Clone; FTL cdna clone
Ordering
For Research Use Only!
Sequence
atgagctcccagattcgtcagaattattccaccgacgtggaggcagccgtcaacagcctggtcaatttgtacctgcaggcctcctacacctacctctctctgggcttctatttcgaccgcgatgatgtggctctggaaggcgtgagccacttcttccgcgaattggccgaggagaagcgcgagggctacgagcgtctcctgaagatgcaaaaccagcgtggcggccgcgctctcttccaggacatcaagaagccagctgaagatgagtggggtaaaaccccagacgccatgaaagctgccatggccctggagaaaaagctgaaccaggcccttttggatcttcatgccctgggttctgcccgcacggacccccatctctgtgacttcctggagactcacttcctagatgaggaagtgaagcttatcaagaagatgggtgaccacctgaccaacctccacaggctgggtggcccggaggctgggctgggcgagtatctcttcgaaaggctcactctcaagcacgactaa
Sequence Length
528
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,020 Da
NCBI Official Full Name
Homo sapiens ferritin, light polypeptide, mRNA
NCBI Official Synonym Full Names
ferritin light chain
NCBI Official Symbol
FTL
NCBI Official Synonym Symbols
LFTD; NBIA3
NCBI Protein Information
ferritin light chain
UniProt Protein Name
Ferritin light chain
Protein Family
UniProt Gene Name
FTL
UniProt Synonym Gene Names
Ferritin L subunit
UniProt Entry Name
FRIL_HUMAN

NCBI Description

This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]

Uniprot Description

FTL: Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. Also plays a role in delivery of iron to cells. Mediates iron uptake in capsule cells of the developing kidney. Defects in FTL are the cause of hereditary hyperferritinemia-cataract syndrome (HHCS). It is an autosomal dominant disease characterized by early-onset bilateral cataract. Affected patients have elevated level of circulating ferritin. HHCS is caused by mutations in the iron responsive element (IRE) of the FTL gene. Defects in FTL are the cause of neurodegeneration with brain iron accumulation type 3 (NBIA3); also known as adult-onset basal ganglia disease. It is a movement disorder with heterogeneous presentations starting in the fourth to sixth decade. It is characterized by a variety of neurological signs including parkinsonism, ataxia, corticospinal signs, mild nonprogressive cognitive deficit and episodic psychosis. It is linked with decreased serum ferritin levels. Belongs to the ferritin family.

Protein type: Oxidoreductase

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: cytosol; ferritin complex; membrane

Molecular Function: identical protein binding; iron ion binding; protein binding

Biological Process: cellular iron ion homeostasis; iron ion homeostasis

Disease: Hyperferritinemia With Or Without Cataract; L-ferritin Deficiency; Neurodegeneration With Brain Iron Accumulation 3

Research Articles on FTL

Similar Products

Product Notes

The FTL ftl (Catalog #AAA1275139) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctccc agattcgtca gaattattcc accgacgtgg aggcagccgt caacagcctg gtcaatttgt acctgcaggc ctcctacacc tacctctctc tgggcttcta tttcgaccgc gatgatgtgg ctctggaagg cgtgagccac ttcttccgcg aattggccga ggagaagcgc gagggctacg agcgtctcct gaagatgcaa aaccagcgtg gcggccgcgc tctcttccag gacatcaaga agccagctga agatgagtgg ggtaaaaccc cagacgccat gaaagctgcc atggccctgg agaaaaagct gaaccaggcc cttttggatc ttcatgccct gggttctgcc cgcacggacc cccatctctg tgacttcctg gagactcact tcctagatga ggaagtgaag cttatcaaga agatgggtga ccacctgacc aacctccaca ggctgggtgg cccggaggct gggctgggcg agtatctctt cgaaaggctc actctcaagc acgactaa. It is sometimes possible for the material contained within the vial of "FTL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.