Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OBSCN cdna clone

OBSCN cDNA Clone

Gene Names
OBSCN; UNC89; ARHGEF30
Synonyms
OBSCN; OBSCN cDNA Clone; OBSCN cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCACTGCACAGTGGATGGAGAAACTGTGATTCTTGTGCTGGGAGGTGGTGGGGCTTCTCCCAGCTACATGGCCAGTGCCAAGCTTGGGAAGGTTCTGTTTCTCCTACTTTCTCGTCTAGGCCCTCCTACCCTAGGGTGGTCTTCCTGACCTGGGCAGTATCTTTGACCTCGTGTGTCCCTCCTTGTCCATCCCCAGAGCCCAAGGTGGTGTTTGCCAAGGAGCAGCCAGCACACAGGGAGGTGCAGGCTGAGGCGGGGGCCAGTGCCACGCTGAGCTGCGAGGTGGCCCAGGCCCAGACAGAGGTGACGTGGTACAAGGATGGGAAGAAGCTGAGTTCCAGCTCGAAAGTGCGCGTGGAGGCCGTGGGCTGCACACGGAGGCTGGTGGTGCAGCAGGCGGGCCAGGCAGAGGCCGGGGAGTACAGCTGCGAGGCAGGGGGTCAGCAGCTCTCCTTCCGCCTGCAGGTGGCAGGTCAGTGCTTTGGGGATGCTGAGTGA
Sequence Length
501
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
924,971 Da
NCBI Official Full Name
Homo sapiens obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF, mRNA
NCBI Official Synonym Full Names
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
NCBI Official Symbol
OBSCN
NCBI Official Synonym Symbols
UNC89; ARHGEF30
NCBI Protein Information
obscurin
UniProt Protein Name
Obscurin
Protein Family
UniProt Gene Name
OBSCN
UniProt Synonym Gene Names
KIAA1556; KIAA1639; Obscurin-MLCK
UniProt Entry Name
OBSCN_HUMAN

NCBI Description

The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 720 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein belongs to the family of giant sacromeric signaling proteins that includes titin and nebulin, and may have a role in the organization of myofibrils during assembly and may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

OBSCN: a Ca(2+)/calmodulin-dependent protein kinase of the Trio family. A giant protein with one Rho GEF domain, one PH domain and two kinase domains. Expressed in skeletal and cardiac muscle, concentrating around Z-disks and M-lines of striated muscle. Binds ankyrin 1 interacts with sarcomeric myosin. May play a critical role in its ability to assemble into A bands in striated muscle.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, CAMK; EC 2.7.11.1; CAMK group; Trio family

Chromosomal Location of Human Ortholog: 1q42.13

Cellular Component: cytosol; M band; Z disc

Molecular Function: ankyrin binding; guanyl-nucleotide exchange factor activity; protein binding; Rho guanyl-nucleotide exchange factor activity; titin binding

Biological Process: positive regulation of apoptosis; regulation of small GTPase mediated signal transduction; sarcomere organization

Research Articles on OBSCN

Similar Products

Product Notes

The OBSCN obscn (Catalog #AAA1275125) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCACTGC ACAGTGGATG GAGAAACTGT GATTCTTGTG CTGGGAGGTG GTGGGGCTTC TCCCAGCTAC ATGGCCAGTG CCAAGCTTGG GAAGGTTCTG TTTCTCCTAC TTTCTCGTCT AGGCCCTCCT ACCCTAGGGT GGTCTTCCTG ACCTGGGCAG TATCTTTGAC CTCGTGTGTC CCTCCTTGTC CATCCCCAGA GCCCAAGGTG GTGTTTGCCA AGGAGCAGCC AGCACACAGG GAGGTGCAGG CTGAGGCGGG GGCCAGTGCC ACGCTGAGCT GCGAGGTGGC CCAGGCCCAG ACAGAGGTGA CGTGGTACAA GGATGGGAAG AAGCTGAGTT CCAGCTCGAA AGTGCGCGTG GAGGCCGTGG GCTGCACACG GAGGCTGGTG GTGCAGCAGG CGGGCCAGGC AGAGGCCGGG GAGTACAGCT GCGAGGCAGG GGGTCAGCAG CTCTCCTTCC GCCTGCAGGT GGCAGGTCAG TGCTTTGGGG ATGCTGAGTG A. It is sometimes possible for the material contained within the vial of "OBSCN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.