Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATF2 cdna clone

ATF2 cDNA Clone

Gene Names
ATF2; HB16; CREB2; TREB7; CREB-2; CRE-BP1
Synonyms
ATF2; ATF2 cDNA Clone; ATF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaattcaagttacatgtgaattctgccaggcaatacaaggacctgtggaatatgagtgatgacaaaccctttctatgtactgcgcctggatgtggccagcgttttaccaacgaggatcatttggctgtccataaacataaacatgagatgacactgaaatttggtccagcacgtaatgacagtgtcattgtggctgatcagaccccaacaccaacaagattcttgaaaaactgtgaagaagtgggtttgtttaatgagttggcgagtccatttgagaatgaattcaagaaagcttcagaagatgacattaaaaaaatgcctctagatttatcccctcttgcaacacctatcataagaagcaaaattgaggagccttctgttgtagaaacaactcaccaggatagtcctttacctcacccagagtctactaccagtgatgagaaggaagtaccattggcacaaactgcacagcccacatcagctattgttcgtccagcatcattacaggttcccaatgtgctgcttacaagttctgactcaagtgtaattattcagcaggcagtaccttcaccaacctcaagtactgtaatcacccaggcaccatcctctaacaggccaattgtgtaa
Sequence Length
630
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,409 Da
NCBI Official Full Name
Homo sapiens activating transcription factor 2, mRNA
NCBI Official Synonym Full Names
activating transcription factor 2
NCBI Official Symbol
ATF2
NCBI Official Synonym Symbols
HB16; CREB2; TREB7; CREB-2; CRE-BP1
NCBI Protein Information
cyclic AMP-dependent transcription factor ATF-2
UniProt Protein Name
Cyclic AMP-dependent transcription factor ATF-2
UniProt Gene Name
ATF2
UniProt Synonym Gene Names
CREB2; CREBP1; cAMP-dependent transcription factor ATF-2; CREB-2; cAMP-responsive element-binding protein 2
UniProt Entry Name
ATF2_HUMAN

NCBI Description

This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]

Uniprot Description

ATF-2: a transcription factor that is a member of the leucine zipper family. Binds to the cAMP-responsive element (CRE). Forms a homodimer or heterodimer with c-Jun and stimulates CRE-dependent transcription. Also possesses histone acetyltransferase (HAT) activity that specifically acetylates histones H2B and H4 in vitro.

Protein type: C2H2-type zinc finger protein; Transcription factor; EC 2.3.1.48

Chromosomal Location of Human Ortholog: 2q32

Cellular Component: cytoplasm; mitochondrial outer membrane; nucleoplasm; nucleus

Molecular Function: cAMP response element binding protein binding; histone acetyltransferase activity; protein binding; protein kinase binding; RNA polymerase II transcription factor activity, enhancer binding; transcription coactivator activity; transcription factor activity

Biological Process: intra-S DNA damage checkpoint; positive regulation of transcription factor activity; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription factor activity; regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent; response to DNA damage stimulus; response to osmotic stress

Research Articles on ATF2

Similar Products

Product Notes

The ATF2 atf2 (Catalog #AAA1275079) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaattca agttacatgt gaattctgcc aggcaataca aggacctgtg gaatatgagt gatgacaaac cctttctatg tactgcgcct ggatgtggcc agcgttttac caacgaggat catttggctg tccataaaca taaacatgag atgacactga aatttggtcc agcacgtaat gacagtgtca ttgtggctga tcagacccca acaccaacaa gattcttgaa aaactgtgaa gaagtgggtt tgtttaatga gttggcgagt ccatttgaga atgaattcaa gaaagcttca gaagatgaca ttaaaaaaat gcctctagat ttatcccctc ttgcaacacc tatcataaga agcaaaattg aggagccttc tgttgtagaa acaactcacc aggatagtcc tttacctcac ccagagtcta ctaccagtga tgagaaggaa gtaccattgg cacaaactgc acagcccaca tcagctattg ttcgtccagc atcattacag gttcccaatg tgctgcttac aagttctgac tcaagtgtaa ttattcagca ggcagtacct tcaccaacct caagtactgt aatcacccag gcaccatcct ctaacaggcc aattgtgtaa. It is sometimes possible for the material contained within the vial of "ATF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.