Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDKN2D cdna clone

CDKN2D cDNA Clone

Gene Names
CDKN2D; p19; INK4D; p19-INK4D
Synonyms
CDKN2D; CDKN2D cDNA Clone; CDKN2D cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctggaggaggttcgcgccggcgaccggctgagtggggcggcggcccggggcgacgtgcaggaggtgcgccgccttctgcaccgcgagctggtgcatcccgacgccctcaaccgcttcggcaagacggcgctgcaggtcatgatgtttggcagcaccgccatcgccctggagctgctgaagcaaggtgccagccccaatgtccaggacacctccggtaccagtccagtccatgacgcagcccgcactggattcctggacaccctgaaggtcctagtggagcacggggctgatgtcaacgtgcctgatggcaccggggcacttccaatccatctggcagttcaagagggtcacactgctgtggtcagctttctggcagctgaatctgatctccatcgcagggacgccaggggtctcacacccttggagctggcactgcagagaggggctcaggacctcgtggacatcctgcagggccacatggtggccccgctgtga
Sequence Length
501
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,700 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4), mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase inhibitor 2D
NCBI Official Symbol
CDKN2D
NCBI Official Synonym Symbols
p19; INK4D; p19-INK4D
NCBI Protein Information
cyclin-dependent kinase 4 inhibitor D
UniProt Protein Name
Cyclin-dependent kinase 4 inhibitor D
UniProt Gene Name
CDKN2D
UniProt Entry Name
CDN2D_HUMAN

NCBI Description

The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

CDKN2D: Interacts strongly with CDK4 and CDK6 and inhibits them. Belongs to the CDKN2 cyclin-dependent kinase inhibitor family.

Protein type: Inhibitor; Cell cycle regulation; Tumor suppressor

Chromosomal Location of Human Ortholog: 19p13

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: cyclin-dependent protein kinase inhibitor activity; protein binding; protein kinase binding

Biological Process: autophagic cell death; cell cycle arrest; DNA synthesis during DNA repair; G1/S transition of mitotic cell cycle; negative regulation of caspase activity; negative regulation of cell growth; negative regulation of cell proliferation; negative regulation of phosphorylation; regulation of cyclin-dependent protein kinase activity; response to retinoic acid; response to UV; response to vitamin D

Research Articles on CDKN2D

Similar Products

Product Notes

The CDKN2D cdkn2d (Catalog #AAA1275066) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgg aggaggttcg cgccggcgac cggctgagtg gggcggcggc ccggggcgac gtgcaggagg tgcgccgcct tctgcaccgc gagctggtgc atcccgacgc cctcaaccgc ttcggcaaga cggcgctgca ggtcatgatg tttggcagca ccgccatcgc cctggagctg ctgaagcaag gtgccagccc caatgtccag gacacctccg gtaccagtcc agtccatgac gcagcccgca ctggattcct ggacaccctg aaggtcctag tggagcacgg ggctgatgtc aacgtgcctg atggcaccgg ggcacttcca atccatctgg cagttcaaga gggtcacact gctgtggtca gctttctggc agctgaatct gatctccatc gcagggacgc caggggtctc acacccttgg agctggcact gcagagaggg gctcaggacc tcgtggacat cctgcagggc cacatggtgg ccccgctgtg a. It is sometimes possible for the material contained within the vial of "CDKN2D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.