Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FZD7 cdna clone

FZD7 cDNA Clone

Gene Names
FZD7; FzE3
Synonyms
FZD7; FZD7 cDNA Clone; FZD7 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgggaccccggcgcggccgctccgctttcgtccctgggcctctgtgccctggtgctggcgctgctgggcgcactgtccgcgggcgccggggcgcagccgtaccacggagagaagggcatctccgtgccggaccacggcttctgccagcccatctccatcccgctgtgcacggacatcgcctacaaccagaccatcctgcccaacctgctgggccacacgaaccaagaggacgcgggcctcgaggtgcaccagttctacccgctggtgaaggtgcagtgttctcccgaactccgctttttcttatgctccatgtatgcgcccgtgtgcaccgtgctcgatcaggccatcccgccgtgtcgttctctgtgcgagcgcgcccgccagggctgcgaggcgctcatgaacaagttcggcttccagtggcccgagcggctgcgctgcgagaacttcccggtgcacggtgcgggcgagatctgcgtgggccagaacacgtcggacggctccgggggcccaggcggcggccccactgcctaccctaccgcgccctacctgccggacctgcccttcaccgcgctgcccccgggggcctcagatggcagggggcgtcccgccttccccttctcatgcccccgtcagctcaaggtgcccccgtacctgggctaccgcttcctgggtgagcgcgattgtggcgccccgtgcgaaccgggccgtgccaacggcctgatgtactttaaggaggaggagaggcgcttcgcccgcctctgggtgggcgtgtggtccgtgctgtgctgcgcctcgacgctctttaccgttctcacctacctggtggacatgcggcgcttcagctacccagagcggcccatcatcttcctgtcgggctgctacttcatggtggccgtggcgcacgtggccggcttccttctagaggaccgcgccgtgtgcgtggagcgcttctcggacgatggctaccgcacggtggcgcagggcaccaagaaggagggctgcaccatcctcttcatggtgctctacttcttcggcatggccagctccatctggtgggtcattctgtctctcacttggttcctggcggccggcatgaagtggggccacgaggccatcgaggccaactcgcagtacttccacctggccgcgtgggccgtgcccgccgtcaagaccatcactatcctggccatgggccaggtagacggggacctgctgagcggggtgtgctacgttggcctctccagtgtggacgcgctgcggggcttcgtgctggcgcctctgttcgtctacctcttcataggcacgtccttcttgctggccggcttcgtgtccctcttccgtatccgcaccatcatgaaacacgacggcaccaagaccgagaagctggagaagctcatggtgcgcatcggcgtcttcagcgtgctctacacagtgcccgccaccatcgtcctggcctgctacttctacgagcaggccttccgcgagcactgggagcgcacctggctcctgcagacgtgcaagagctatgccgtgccctgcccgcccggccacttcccgcccatgagccccgacttcaccgtcttcatgatcaagtacctgatgaccatgatcgtcggcatcaccactggcttctggatctggtcgggcaagaccctgcagtcgtggcgccgcttctaccacagacttagccacagcagcaagggggagactgcggtatga
Sequence Length
1725
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,620 Da
NCBI Official Full Name
Homo sapiens frizzled homolog 7 (Drosophila), mRNA
NCBI Official Synonym Full Names
frizzled class receptor 7
NCBI Official Symbol
FZD7
NCBI Official Synonym Symbols
FzE3
NCBI Protein Information
frizzled-7
UniProt Protein Name
Frizzled-7
Protein Family
UniProt Gene Name
FZD7
UniProt Synonym Gene Names
Fz-7; hFz7
UniProt Entry Name
FZD7_HUMAN

NCBI Description

Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD7 protein contains an N-terminal signal sequence, 10 cysteine residues typical of the cysteine-rich extracellular domain of Fz family members, 7 putative transmembrane domains, and an intracellular C-terminal tail with a PDZ domain-binding motif. FZD7 gene expression may downregulate APC function and enhance beta-catenin-mediated signals in poorly differentiated human esophageal carcinomas. [provided by RefSeq, Jul 2008]

Uniprot Description

FZD7: Receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK- 3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. May be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. Belongs to the G-protein coupled receptor Fz/Smo family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Receptor, GPCR; GPCR, Fz/Smo family; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q33

Cellular Component: integral to membrane; plasma membrane

Molecular Function: frizzled binding; G-protein coupled receptor activity; PDZ domain binding; protein binding; Wnt receptor activity; Wnt-protein binding

Biological Process: negative regulation of ectodermal cell fate specification; neuron differentiation; positive regulation of epithelial cell proliferation involved in wound healing; positive regulation of JNK cascade; positive regulation of phosphorylation; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; stem cell maintenance; Wnt receptor signaling pathway through beta-catenin; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on FZD7

Similar Products

Product Notes

The FZD7 fzd7 (Catalog #AAA1275047) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggacc ccggcgcggc cgctccgctt tcgtccctgg gcctctgtgc cctggtgctg gcgctgctgg gcgcactgtc cgcgggcgcc ggggcgcagc cgtaccacgg agagaagggc atctccgtgc cggaccacgg cttctgccag cccatctcca tcccgctgtg cacggacatc gcctacaacc agaccatcct gcccaacctg ctgggccaca cgaaccaaga ggacgcgggc ctcgaggtgc accagttcta cccgctggtg aaggtgcagt gttctcccga actccgcttt ttcttatgct ccatgtatgc gcccgtgtgc accgtgctcg atcaggccat cccgccgtgt cgttctctgt gcgagcgcgc ccgccagggc tgcgaggcgc tcatgaacaa gttcggcttc cagtggcccg agcggctgcg ctgcgagaac ttcccggtgc acggtgcggg cgagatctgc gtgggccaga acacgtcgga cggctccggg ggcccaggcg gcggccccac tgcctaccct accgcgccct acctgccgga cctgcccttc accgcgctgc ccccgggggc ctcagatggc agggggcgtc ccgccttccc cttctcatgc ccccgtcagc tcaaggtgcc cccgtacctg ggctaccgct tcctgggtga gcgcgattgt ggcgccccgt gcgaaccggg ccgtgccaac ggcctgatgt actttaagga ggaggagagg cgcttcgccc gcctctgggt gggcgtgtgg tccgtgctgt gctgcgcctc gacgctcttt accgttctca cctacctggt ggacatgcgg cgcttcagct acccagagcg gcccatcatc ttcctgtcgg gctgctactt catggtggcc gtggcgcacg tggccggctt ccttctagag gaccgcgccg tgtgcgtgga gcgcttctcg gacgatggct accgcacggt ggcgcagggc accaagaagg agggctgcac catcctcttc atggtgctct acttcttcgg catggccagc tccatctggt gggtcattct gtctctcact tggttcctgg cggccggcat gaagtggggc cacgaggcca tcgaggccaa ctcgcagtac ttccacctgg ccgcgtgggc cgtgcccgcc gtcaagacca tcactatcct ggccatgggc caggtagacg gggacctgct gagcggggtg tgctacgttg gcctctccag tgtggacgcg ctgcggggct tcgtgctggc gcctctgttc gtctacctct tcataggcac gtccttcttg ctggccggct tcgtgtccct cttccgtatc cgcaccatca tgaaacacga cggcaccaag accgagaagc tggagaagct catggtgcgc atcggcgtct tcagcgtgct ctacacagtg cccgccacca tcgtcctggc ctgctacttc tacgagcagg ccttccgcga gcactgggag cgcacctggc tcctgcagac gtgcaagagc tatgccgtgc cctgcccgcc cggccacttc ccgcccatga gccccgactt caccgtcttc atgatcaagt acctgatgac catgatcgtc ggcatcacca ctggcttctg gatctggtcg ggcaagaccc tgcagtcgtg gcgccgcttc taccacagac ttagccacag cagcaagggg gagactgcgg tatga. It is sometimes possible for the material contained within the vial of "FZD7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.