EFHC1 cdna clone
EFHC1 cDNA Clone
Gene Names
EFHC1; EJM1; dJ304B14.2
Synonyms
EFHC1; EFHC1 cDNA Clone; EFHC1 cdna clone
Sequence
atggtgtccaatcccgtgcatggcttgccctttcttccgggcacgtcctttaaggactctacgaaaacagccttccacagaagtcagacgctgagctacaggaacggctatgcaattgttcgacgtccaacagttgggataggcggagaccggctccagttcaaccagctgtcccaggctgagctggatgagttggccagtaaggcaccagtcttaacttatggccaacctaaacaagccccacctgcggattttattcctgcgcatgtggcctttgacaaaaaggtactgaaatttgatgcctatttccaagaagatgttcctatgtcaactgaggaacagtataggatccgtcaggtgaacatttactattatctagaagatgacagcatgtctgtcatagagcctgttgtagaaaattctggaatccttcaaggcaagttaataaaacgccagcggctagccaagaatgaccggggtgaccattaccattggaaagacctaaatcgaggaataaacatcacaatttatggcaaaactttccgcgttgttgactgtgaccaattcacacaggtatttttagaaagccaaggaattgagttaaatccaccagagaagatggctcttgatccttacactgaactccgaaaacagcctcttcgtaagtatgtcaccccatcagactttgatcaactcaagcaatttctcacctttgacaaacaggtccttcgattctatgcaatctgggatgatacagacagcatgtatggtgaatgtcggacctacatcattcattactatcttatggatgatacggtggaaattcgagaggtccacgaacggaatgatgggatagatcctttcccactcctaatgaaccgccagcgtgtgcccaaagttttggtggaaaatgcaaagaacttccctcagtgtgtgctagaaatctctgaccaagaagtgttggaatggtatactgctaaagacttcattgttgggaagtcactcactatccttgggagaactttcttcatttatgattgtgatccatttactcgacggtattacaaagagaagtttggaatcactgatttaccacgtattgatgtgagcaagcgggaaccacctccagtaaaacaggagttgcctccttataacggttttggactagtggaagattctgctcagaattgttttgctctcattccaaaagctccaaaaaaagacgttattaaaatgctggtgaatgataacaaggtgcttcgttatttggctgtactggaatcccccatcccagaagacaaagaccgcagatttgtcttctcttactttctagctaccgacatgatcagtatctttgagcctcctgttcgcaattctggtatcattgggggcaagtaccttggcaggactaaagttgttaaaccatactctacagtggacaaccctgtctactatggccccagtgacttcttcattggtgctgtgattgaagtgtttggtcaccggttcatcatccttgatacagacgagtatgttttgaaatacatggagagcaacgctgcccagtattcaccagaagcactcgcgtcaattcagaaccatgtccgaaagcgagaagcgcctgctccagaagcagaaagcaagcaaactgaaaaggatccaggcgtgcaggaattggaagcattaatagacacaattcagaagcaactgaaagatcactcatgcaaagacaacattcgtgaggcatttcaaatttatgacaaggaagcttcaggatatgtggacagagacatgttctttaaaatctgtgaatcgcttaacgtcccagtggatgactccttggttaaggagttactcaggatgtgctctcatggagaaggcaaaattaactactataactttgttcgtgctttctcaaactga
Sequence Length
1923
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
72,021 Da
NCBI Official Full Name
Homo sapiens EF-hand domain (C-terminal) containing 1, mRNA
NCBI Official Synonym Full Names
EF-hand domain containing 1
NCBI Official Symbol
EFHC1
NCBI Official Synonym Symbols
EJM1; dJ304B14.2
NCBI Protein Information
EF-hand domain-containing protein 1
UniProt Protein Name
EF-hand domain-containing protein 1
Protein Family
UniProt Gene Name
EFHC1
UniProt Entry Name
EFHC1_HUMAN
NCBI Description
This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Uniprot Description
EFHC1: microtubule-associated protein (MAP) that is abundant in sperm flagella and motile cilia but expressed at low levels in the adult brain. It is not present in immotile primary cilia. May enhance calcium influx through CACNA1E and stimulate programmed cell death. Interacts with the C-terminus of CACNA1E. Implicated in neuronal migration and may play a role during brain development. Mutations in EFHC1 gene have been previously reported in patients with epilepsies, including those with juvenile myoclonic epilepsy. Two alternatively spliced human isoforms have been described.
Chromosomal Location of Human Ortholog: 6p12.3
Cellular Component: axoneme; cell soma; centrosome
Molecular Function: protein binding; protein C-terminus binding
Biological Process: cerebral cortex cell migration
Disease: Epilepsy, Juvenile Absence, Susceptibility To, 1; Epilepsy, Myoclonic Juvenile
Research Articles on EFHC1
Similar Products
Product Notes
The EFHC1 efhc1 (Catalog #AAA1275033) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtcca atcccgtgca tggcttgccc tttcttccgg gcacgtcctt taaggactct acgaaaacag ccttccacag aagtcagacg ctgagctaca ggaacggcta tgcaattgtt cgacgtccaa cagttgggat aggcggagac cggctccagt tcaaccagct gtcccaggct gagctggatg agttggccag taaggcacca gtcttaactt atggccaacc taaacaagcc ccacctgcgg attttattcc tgcgcatgtg gcctttgaca aaaaggtact gaaatttgat gcctatttcc aagaagatgt tcctatgtca actgaggaac agtataggat ccgtcaggtg aacatttact attatctaga agatgacagc atgtctgtca tagagcctgt tgtagaaaat tctggaatcc ttcaaggcaa gttaataaaa cgccagcggc tagccaagaa tgaccggggt gaccattacc attggaaaga cctaaatcga ggaataaaca tcacaattta tggcaaaact ttccgcgttg ttgactgtga ccaattcaca caggtatttt tagaaagcca aggaattgag ttaaatccac cagagaagat ggctcttgat ccttacactg aactccgaaa acagcctctt cgtaagtatg tcaccccatc agactttgat caactcaagc aatttctcac ctttgacaaa caggtccttc gattctatgc aatctgggat gatacagaca gcatgtatgg tgaatgtcgg acctacatca ttcattacta tcttatggat gatacggtgg aaattcgaga ggtccacgaa cggaatgatg ggatagatcc tttcccactc ctaatgaacc gccagcgtgt gcccaaagtt ttggtggaaa atgcaaagaa cttccctcag tgtgtgctag aaatctctga ccaagaagtg ttggaatggt atactgctaa agacttcatt gttgggaagt cactcactat ccttgggaga actttcttca tttatgattg tgatccattt actcgacggt attacaaaga gaagtttgga atcactgatt taccacgtat tgatgtgagc aagcgggaac cacctccagt aaaacaggag ttgcctcctt ataacggttt tggactagtg gaagattctg ctcagaattg ttttgctctc attccaaaag ctccaaaaaa agacgttatt aaaatgctgg tgaatgataa caaggtgctt cgttatttgg ctgtactgga atcccccatc ccagaagaca aagaccgcag atttgtcttc tcttactttc tagctaccga catgatcagt atctttgagc ctcctgttcg caattctggt atcattgggg gcaagtacct tggcaggact aaagttgtta aaccatactc tacagtggac aaccctgtct actatggccc cagtgacttc ttcattggtg ctgtgattga agtgtttggt caccggttca tcatccttga tacagacgag tatgttttga aatacatgga gagcaacgct gcccagtatt caccagaagc actcgcgtca attcagaacc atgtccgaaa gcgagaagcg cctgctccag aagcagaaag caagcaaact gaaaaggatc caggcgtgca ggaattggaa gcattaatag acacaattca gaagcaactg aaagatcact catgcaaaga caacattcgt gaggcatttc aaatttatga caaggaagct tcaggatatg tggacagaga catgttcttt aaaatctgtg aatcgcttaa cgtcccagtg gatgactcct tggttaagga gttactcagg atgtgctctc atggagaagg caaaattaac tactataact ttgttcgtgc tttctcaaac tga. It is sometimes possible for the material contained within the vial of "EFHC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
