Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX1 cdna clone

DDX1 cDNA Clone

Gene Names
DDX1; DBP-RB; UKVH5d
Synonyms
DDX1; DDX1 cDNA Clone; DDX1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcagaaacaggaagtggcaaaactggtgcttttagtattccagttatccagatagtttatgaaactctgaaagaccaacaggaaggcaaaaaaggaaaaacaacaattaaaactggtgcttcagtgctgaacaaatggcagatgaacccatatgacagaggatctgcttttgcaattgggtcagatggtctttgttgtcaaagcagagaagtaaaggaatggcatgggtgtagagctactaaaggattaatgaaagggaaacactactatgaagtatcctgtcatgaccaagggttatgcagggtcgggtggtctaccatgcaggcctctttggacctaggtactgacaagtttggatttggctttggtggaacaggaaagaaatcccataacaaacaatttgataattatggagaggaattcactatgcatgataccattggatgttacctggatatagataagggacatgtcaagttctccaaaaatggaaaagatcttggtctggcatttgaaataccaccacatatgaaaaaccaagccctctttcctgcctgtgttttgaagaatgctgaactgaaatttaacttcggtgaagaggaatttaagtttccaccaaaagatggctttgttgctctttccaaggcaccggatggttacattgtcaaatcacagcactcaggtaatgcacaggtgacacaaacaaagtttctccccaatgctccgaaagctctcattgttgaaccttcccgggagttagctgaacaaactttgaataacatcaagcagtttaagaaatacattgataatcctaaattaagggagcttctgataattggaggtgttgcagcccgggatcagctctctgttttggaaaatggagtagatatagttgtaggtactccgggaagactagatgacttggtgtcaactggaaagctgaacttatctcaagttagattcctggtcctggatgaagctgatgggcttctttctcaaggttattctgattttataaataggatgcacaatcagattcctcaggttacctctgatggaaaaagacttcaggtgattgtttgctctgccactttgcattctttcgatgtaaagaaactgtccgagaagataatgcattttcctacatgggttgacttaaaaggagaagactctgttccagatactgtacaccatgttgttgtcccagtaaatcccaaaactgacagactctgggaaaggcttggaaagagccacattagaactgatgatgtacatgcaaaagataacacaagacctggtgctaatagtccagagatgtggtctgaagctattaaaatcctgaaaggggagtatgctgtccgggcaatcaaggaacataagatggatcaagcaattatcttctgtagaaccaaaattgactgtgataacttggagcagtactttatacaacaaggaggaggacctgataaaaaaggacaccagttctcatgtgtttgtcttcatggtgacagaaagcctcatgagagaaagcaaaacttggaaagatttaagaaaggagatgtaagattcttgatttgcacagatgtagctgctagaggaattgatatccacggtgttccttatgttataaatgtcactctgcccgatgaaaagcaaaactacgtacatcgaattggcagagtaggaagagctgaaaggatgggtctggcaatttccctggtggcaacagaaaaagaaaaggtttggtaccatgtatgtagcagccgtggaaaagggtgttataacacaagactcaaggaagatggaggctgtaccatatggtacaacgagatgcagttactatctgagatagaagaacacctgaactgtaccatttctcaggttgagccggatataaaggtaccagtggatgaatttgatgggaaagttacctacggtcagaaaagggctgctggtggtggaagctataaaggccatgtggatattttggcacctactgttcaagagttggctgcccttgaaaaggaggcgcagacatctttcctgcatcttggctaccttcctaaccagctgttcagaaccttctga
Sequence Length
2094
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,712 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:3835131, containing frame-shift errors
NCBI Official Synonym Full Names
DEAD/H-box helicase 1
NCBI Official Symbol
DDX1
NCBI Official Synonym Symbols
DBP-RB; UKVH5d
NCBI Protein Information
ATP-dependent RNA helicase DDX1
UniProt Protein Name
ATP-dependent RNA helicase DDX1
UniProt Gene Name
DDX1
UniProt Synonym Gene Names
DBP-RB
UniProt Entry Name
DDX1_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX1: Acts as an ATP-dependent RNA helicase, able to unwind both RNA-RNA and RNA-DNA duplexes. Possesses 5' single-stranded RNA overhang nuclease activity. Possesses ATPase activity on various RNA, but not DNA polynucleotides. May play a role in RNA clearance at DNA double-strand breaks (DSBs), thereby facilitating the template-guided repair of transcriptionally active regions of the genome. Together with RELA, acts as a coactivator to enhance NF-kappa-B-mediated transcriptional activation. Acts as a positive transcriptional regulator of cyclin CCND2 expression. Binds to the cyclin CCND2 promoter region. Associates with chromatin at the NF- kappa-B promoter region via association with RELA. Binds to poly(A) RNA. May be involved in 3'-end cleavage and polyadenylation of pre-mRNAs. Required for HIV-1 Rev function as well as for HIV-1 replication. Binds to the RRE sequence of HIV-1 mRNAs. Belongs to the DEAD box helicase family. DDX1 subfamily.

Protein type: Helicase; EC 3.6.4.13; RNA-binding

Chromosomal Location of Human Ortholog: 2p24

Cellular Component: cytoplasm; membrane; nucleoplasm; nucleus; ribonucleoprotein complex; stress granule

Molecular Function: ATP-dependent helicase activity; ATP-dependent RNA helicase activity; chromatin binding; DNA/RNA helicase activity; nuclease activity; poly(A) binding; protein binding; RNA helicase activity; transcription cofactor activity

Biological Process: DNA duplex unwinding; double-strand break repair; multicellular organismal development; RNA secondary structure unwinding; tRNA splicing

Research Articles on DDX1

Similar Products

Product Notes

The DDX1 ddx1 (Catalog #AAA1275018) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag aaacaggaag tggcaaaact ggtgctttta gtattccagt tatccagata gtttatgaaa ctctgaaaga ccaacaggaa ggcaaaaaag gaaaaacaac aattaaaact ggtgcttcag tgctgaacaa atggcagatg aacccatatg acagaggatc tgcttttgca attgggtcag atggtctttg ttgtcaaagc agagaagtaa aggaatggca tgggtgtaga gctactaaag gattaatgaa agggaaacac tactatgaag tatcctgtca tgaccaaggg ttatgcaggg tcgggtggtc taccatgcag gcctctttgg acctaggtac tgacaagttt ggatttggct ttggtggaac aggaaagaaa tcccataaca aacaatttga taattatgga gaggaattca ctatgcatga taccattgga tgttacctgg atatagataa gggacatgtc aagttctcca aaaatggaaa agatcttggt ctggcatttg aaataccacc acatatgaaa aaccaagccc tctttcctgc ctgtgttttg aagaatgctg aactgaaatt taacttcggt gaagaggaat ttaagtttcc accaaaagat ggctttgttg ctctttccaa ggcaccggat ggttacattg tcaaatcaca gcactcaggt aatgcacagg tgacacaaac aaagtttctc cccaatgctc cgaaagctct cattgttgaa ccttcccggg agttagctga acaaactttg aataacatca agcagtttaa gaaatacatt gataatccta aattaaggga gcttctgata attggaggtg ttgcagcccg ggatcagctc tctgttttgg aaaatggagt agatatagtt gtaggtactc cgggaagact agatgacttg gtgtcaactg gaaagctgaa cttatctcaa gttagattcc tggtcctgga tgaagctgat gggcttcttt ctcaaggtta ttctgatttt ataaatagga tgcacaatca gattcctcag gttacctctg atggaaaaag acttcaggtg attgtttgct ctgccacttt gcattctttc gatgtaaaga aactgtccga gaagataatg cattttccta catgggttga cttaaaagga gaagactctg ttccagatac tgtacaccat gttgttgtcc cagtaaatcc caaaactgac agactctggg aaaggcttgg aaagagccac attagaactg atgatgtaca tgcaaaagat aacacaagac ctggtgctaa tagtccagag atgtggtctg aagctattaa aatcctgaaa ggggagtatg ctgtccgggc aatcaaggaa cataagatgg atcaagcaat tatcttctgt agaaccaaaa ttgactgtga taacttggag cagtacttta tacaacaagg aggaggacct gataaaaaag gacaccagtt ctcatgtgtt tgtcttcatg gtgacagaaa gcctcatgag agaaagcaaa acttggaaag atttaagaaa ggagatgtaa gattcttgat ttgcacagat gtagctgcta gaggaattga tatccacggt gttccttatg ttataaatgt cactctgccc gatgaaaagc aaaactacgt acatcgaatt ggcagagtag gaagagctga aaggatgggt ctggcaattt ccctggtggc aacagaaaaa gaaaaggttt ggtaccatgt atgtagcagc cgtggaaaag ggtgttataa cacaagactc aaggaagatg gaggctgtac catatggtac aacgagatgc agttactatc tgagatagaa gaacacctga actgtaccat ttctcaggtt gagccggata taaaggtacc agtggatgaa tttgatggga aagttaccta cggtcagaaa agggctgctg gtggtggaag ctataaaggc catgtggata ttttggcacc tactgttcaa gagttggctg cccttgaaaa ggaggcgcag acatctttcc tgcatcttgg ctaccttcct aaccagctgt tcagaacctt ctga. It is sometimes possible for the material contained within the vial of "DDX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.