Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SRPR cdna clone

SRPR cDNA Clone

Gene Names
SRPRA; DP; SRPR; Sralpha
Synonyms
SRPR; SRPR cDNA Clone; SRPR cdna clone
Ordering
For Research Use Only!
Sequence
atgctcgacttcttcaccattttctccaagggcgggcttgtgctctggtgcttccagggcgttagcgactcatgcaccggacccgttaacgcgttgattcgttccgtgctgctgcaggaacggggaggtaacaactccttcacccatgaggcactcacactcaagtataaactggacaaccagtttgagctggtgtttgtggttggttttcagaagatcctgacactgacatatgtagacaaattgatagatgacgtgcatcggctgtttcgggacaagtaccgcacagagatccaacagcaaagtgctttaagtttattaaatggcacttttgatttccaaaatgacttcctgcggctccttcgtgaagcagaggagagcagtaagatccgtgctcccactaccatgaagaaatttgaagattctgaaaaggccaagaaacctgtgaggtccatgattgagacacggggggaaaagcccaaggaaaaagcaaagaatagcaaaaaaaagggggccaagaaggaaggttctgatggtcctttggctaccagcaaaccagtccctgcagaaaagtcaggtcttccagtgggtcctgagaacggagtagaactttccaaagaggagctgatccgcaggaagcgcgaggagttcattcagaagcatgggaggggtatggagaagtccaacaagtccacgaagtcagatgctccaaaggagaagggcaaaaaagcaccccgggtgtgggaactgggtggctgtgctaacaaagaagtgttggattacagtactcccaccaccaatggaacccctgaggctgccttgtctgaggacatcaacctgattcgagggactgggtctggggggcagcttcaggatctggactgcagcagctctgatgacgaaggggctgctcaaaactctaccaaacctagtgcgaccaagggaacactgggtggcatgtttggtatgctgaagggccttgtgggttcaaagagcttgagtcgtgaagacatggaatctgtgctggacaagatgcgtgatcatctcattgctaagaacgtggctgcagacattgccgtccagctctgtgaatctgttgccaacaagttggaagggaaggtgatggggacgttcagcacggtgacttccacagtaaagcaagccctacaggagtccctggtgcagattctgcagccacagcgtcgtgtagacatgctccgggacatcatggatgcccagcgtcgccagcgcccttatgtcgtcaccttctgcggcgttaatggagtggggaaatctactaatcttgccaagatttccttctggttgttagagaatggcttcagtgtcctcattgctgcctgtgatacatttcgtgctggggccgtggagcagctgcgtacacacacccggcgtttgagtgccctacaccctccagagaagcatggtggccgcaccatggtgcagttgtttgaaaagggctatggcaaggatgctgctggcattgccatggaagccattgcttttgcacgtaaccaaggctttgacgtggtgctggtggacacggcaggccgcatgcaagacaatgcccctctgatgactgccctggccaaactcattactgtcaatacacctgatttggtgctgtttgtaggagaagccttagtaggcaatgaagccgtggaccagctggtcaagttcaacagagccttggctgaccattctatggcttag
Sequence Length
1731
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,559 Da
NCBI Official Full Name
Homo sapiens signal recognition particle receptor ('docking protein'), mRNA
NCBI Official Synonym Full Names
SRP receptor alpha subunit
NCBI Official Symbol
SRPRA
NCBI Official Synonym Symbols
DP; SRPR; Sralpha
NCBI Protein Information
signal recognition particle receptor subunit alpha
UniProt Protein Name
Signal recognition particle receptor subunit alpha
UniProt Gene Name
SRPRA
UniProt Synonym Gene Names
SR-alpha; DP-alpha
UniProt Entry Name
SRPRA_HUMAN

NCBI Description

The gene encodes a subunit of the endoplasmic reticulum signal recognition particle receptor that, in conjunction with the signal recognition particle, is involved in the targeting and translocation of signal sequence tagged secretory and membrane proteins across the endoplasmic reticulum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]

Uniprot Description

SRPR: Component of the SRP (signal recognition particle) receptor. Ensures, in conjunction with the signal recognition particle, the correct targeting of the nascent secretory proteins to the endoplasmic reticulum membrane system. Belongs to the GTP-binding SRP family.

Protein type: Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; integral to membrane; membrane

Biological Process: cotranslational protein targeting to membrane

Similar Products

Product Notes

The SRPR srpra (Catalog #AAA1274972) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcgact tcttcaccat tttctccaag ggcgggcttg tgctctggtg cttccagggc gttagcgact catgcaccgg acccgttaac gcgttgattc gttccgtgct gctgcaggaa cggggaggta acaactcctt cacccatgag gcactcacac tcaagtataa actggacaac cagtttgagc tggtgtttgt ggttggtttt cagaagatcc tgacactgac atatgtagac aaattgatag atgacgtgca tcggctgttt cgggacaagt accgcacaga gatccaacag caaagtgctt taagtttatt aaatggcact tttgatttcc aaaatgactt cctgcggctc cttcgtgaag cagaggagag cagtaagatc cgtgctccca ctaccatgaa gaaatttgaa gattctgaaa aggccaagaa acctgtgagg tccatgattg agacacgggg ggaaaagccc aaggaaaaag caaagaatag caaaaaaaag ggggccaaga aggaaggttc tgatggtcct ttggctacca gcaaaccagt ccctgcagaa aagtcaggtc ttccagtggg tcctgagaac ggagtagaac tttccaaaga ggagctgatc cgcaggaagc gcgaggagtt cattcagaag catgggaggg gtatggagaa gtccaacaag tccacgaagt cagatgctcc aaaggagaag ggcaaaaaag caccccgggt gtgggaactg ggtggctgtg ctaacaaaga agtgttggat tacagtactc ccaccaccaa tggaacccct gaggctgcct tgtctgagga catcaacctg attcgaggga ctgggtctgg ggggcagctt caggatctgg actgcagcag ctctgatgac gaaggggctg ctcaaaactc taccaaacct agtgcgacca agggaacact gggtggcatg tttggtatgc tgaagggcct tgtgggttca aagagcttga gtcgtgaaga catggaatct gtgctggaca agatgcgtga tcatctcatt gctaagaacg tggctgcaga cattgccgtc cagctctgtg aatctgttgc caacaagttg gaagggaagg tgatggggac gttcagcacg gtgacttcca cagtaaagca agccctacag gagtccctgg tgcagattct gcagccacag cgtcgtgtag acatgctccg ggacatcatg gatgcccagc gtcgccagcg cccttatgtc gtcaccttct gcggcgttaa tggagtgggg aaatctacta atcttgccaa gatttccttc tggttgttag agaatggctt cagtgtcctc attgctgcct gtgatacatt tcgtgctggg gccgtggagc agctgcgtac acacacccgg cgtttgagtg ccctacaccc tccagagaag catggtggcc gcaccatggt gcagttgttt gaaaagggct atggcaagga tgctgctggc attgccatgg aagccattgc ttttgcacgt aaccaaggct ttgacgtggt gctggtggac acggcaggcc gcatgcaaga caatgcccct ctgatgactg ccctggccaa actcattact gtcaatacac ctgatttggt gctgtttgta ggagaagcct tagtaggcaa tgaagccgtg gaccagctgg tcaagttcaa cagagccttg gctgaccatt ctatggctta g. It is sometimes possible for the material contained within the vial of "SRPR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.