EGFL6 cdna clone
EGFL6 cDNA Clone
Gene Names
EGFL6; W80; MAEG
Synonyms
EGFL6; EGFL6 cDNA Clone; EGFL6 cdna clone
Sequence
atgcctctgccctggagccttgcgctcccgctgctgctctcctgggtggcaggtggtttcgggaacgcggccagtgcaaggcatcacgggttgttagcatcggcacgtcagcctggggtctgtcactatggaactaaactggcctgctgctacggctggagaagaaacagcaagggagtctgtgaagctacatgcgaacctggatgtaagtttggtgagtgcgtgggaccaaacaaatgcagatgctttccaggatacaccgggaaaacctgcagtcaagatgtgaatgagtgtggaatgaaaccccggccatgccaacacagatgtgtgaatacacacggaagctacaagtgcttttgcctcagtggccacatgctcatgccagatgctacgtgtgtgaactctaggacatgtgccatgataaactgtcagtacagctgtgaagacacagaagaagggccacagtgcctgtgtccatcctcaggactccgcctggccccaaatggaagagactgtctagatattgatgaatgtgcctctggtaaagtcatctgtccctacaatcgaagatgtgtgaacacatttggaagctactactgcaaatgtcacattggtttcgaactgcaatatatcagtggacgatatgactgtatagatataaatgaatgtactatggatagccatacgtgcagccaccatgccaattgcttcaatacccaagggtccttcaagtgtaaatgcaagcagggatataaaggcaatggacttcggtgttctgctatccctgaaaattctgtgaaggaagtcctcagagcacctggtaccatcaaagacagaatcaagaagttgcttgctcacaaaaacagcatgaaaaagaaggcaaaaattaaaaatgttaccccagaacccaccaggactcctacccctaaggtgaacttgcagcccttcaactatgaagagatagtttccagaggcgggaactctcatggaggtaaaaaagggaatgaagagaaaatgaaagaggggcttgaggatgagaaaagagaagagaaagccctgaagaatgacatagaggagcgaagcctgcgaggagatgtgtttttccctaaggtgaatgaagcaggtgaattcggcctgattctggtccaaaggaaagcgctaacttccaaactggaacataaagatttaaatatctcggttgactgcagcttcaatcatgggatctgtgactggaaacaggatagagaagatgattttgactggaatcctgctgatcgagataatgctattggcttctatatggcagttccggccttggcaggtcacaagaaagacattggccgattgaaacttctcctacctgacctgcaaccccaaagcaacttctgtttgctctttgattaccggctggccggagacaaagtcgggaaacttcgagtgtttgtgaaaaacagtaacaatgccctggcatgggagaagaccacgagtgaggatgaaaagtggaagacagggaaaattcagttgtatcaaggaactgatgctaccaaaagcatcatttttgaagcagaacgtggcaagggcaaaaccggcgaaatcgcagtggatggcgtcttgcttgtttcaggcttatgtccagatagccttttatctgtggatgactga
Sequence Length
1662
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,388 Da
NCBI Official Full Name
Homo sapiens EGF-like-domain, multiple 6, mRNA
NCBI Official Synonym Full Names
EGF like domain multiple 6
NCBI Official Symbol
EGFL6
NCBI Official Synonym Symbols
W80; MAEG
NCBI Protein Information
epidermal growth factor-like protein 6
UniProt Protein Name
Epidermal growth factor-like protein 6
Protein Family
UniProt Gene Name
EGFL6
UniProt Synonym Gene Names
MAEG; EGF-like protein 6
UniProt Entry Name
EGFL6_HUMAN
NCBI Description
This gene encodes a member of the epidermal growth factor (EGF) repeat superfamily. Members of this superfamily are characterized by the presence of EGF-like repeats and are often involved in the regulation of cell cycle, proliferation, and developmental processes. The gene product contains a signal peptide, suggesting that it is secreted; an EGF repeat region consisting of 4 complete EGF-like repeats and 1 partial EGF-like repeat, 3 of which have a calcium-binding consensus sequence; an arg-gly-asp integrin association motif; and a MAM domain, which is believed to have an adhesive function. This gene is expressed early during development, and its expression has been detected in lung and meningioma tumors. [provided by RefSeq, Jul 2008]
Uniprot Description
EGFL6: May bind integrin alpha-8/beta-1 and play a role in hair follicle morphogenesis. Promotes matrix assembly. Belongs to the nephronectin family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: Xp22
Cellular Component: extracellular space
Molecular Function: integrin binding
Biological Process: cell cycle
Research Articles on EGFL6
Similar Products
Product Notes
The EGFL6 egfl6 (Catalog #AAA1274969) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctctgc cctggagcct tgcgctcccg ctgctgctct cctgggtggc aggtggtttc gggaacgcgg ccagtgcaag gcatcacggg ttgttagcat cggcacgtca gcctggggtc tgtcactatg gaactaaact ggcctgctgc tacggctgga gaagaaacag caagggagtc tgtgaagcta catgcgaacc tggatgtaag tttggtgagt gcgtgggacc aaacaaatgc agatgctttc caggatacac cgggaaaacc tgcagtcaag atgtgaatga gtgtggaatg aaaccccggc catgccaaca cagatgtgtg aatacacacg gaagctacaa gtgcttttgc ctcagtggcc acatgctcat gccagatgct acgtgtgtga actctaggac atgtgccatg ataaactgtc agtacagctg tgaagacaca gaagaagggc cacagtgcct gtgtccatcc tcaggactcc gcctggcccc aaatggaaga gactgtctag atattgatga atgtgcctct ggtaaagtca tctgtcccta caatcgaaga tgtgtgaaca catttggaag ctactactgc aaatgtcaca ttggtttcga actgcaatat atcagtggac gatatgactg tatagatata aatgaatgta ctatggatag ccatacgtgc agccaccatg ccaattgctt caatacccaa gggtccttca agtgtaaatg caagcaggga tataaaggca atggacttcg gtgttctgct atccctgaaa attctgtgaa ggaagtcctc agagcacctg gtaccatcaa agacagaatc aagaagttgc ttgctcacaa aaacagcatg aaaaagaagg caaaaattaa aaatgttacc ccagaaccca ccaggactcc tacccctaag gtgaacttgc agcccttcaa ctatgaagag atagtttcca gaggcgggaa ctctcatgga ggtaaaaaag ggaatgaaga gaaaatgaaa gaggggcttg aggatgagaa aagagaagag aaagccctga agaatgacat agaggagcga agcctgcgag gagatgtgtt tttccctaag gtgaatgaag caggtgaatt cggcctgatt ctggtccaaa ggaaagcgct aacttccaaa ctggaacata aagatttaaa tatctcggtt gactgcagct tcaatcatgg gatctgtgac tggaaacagg atagagaaga tgattttgac tggaatcctg ctgatcgaga taatgctatt ggcttctata tggcagttcc ggccttggca ggtcacaaga aagacattgg ccgattgaaa cttctcctac ctgacctgca accccaaagc aacttctgtt tgctctttga ttaccggctg gccggagaca aagtcgggaa acttcgagtg tttgtgaaaa acagtaacaa tgccctggca tgggagaaga ccacgagtga ggatgaaaag tggaagacag ggaaaattca gttgtatcaa ggaactgatg ctaccaaaag catcattttt gaagcagaac gtggcaaggg caaaaccggc gaaatcgcag tggatggcgt cttgcttgtt tcaggcttat gtccagatag ccttttatct gtggatgact ga. It is sometimes possible for the material contained within the vial of "EGFL6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
