Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAS1L cdna clone

MAS1L cDNA Clone

Gene Names
MAS1L; MRG; MAS-L; dJ994E9.2
Synonyms
MAS1L; MAS1L cDNA Clone; MAS1L cdna clone
Ordering
For Research Use Only!
Sequence
atggtctgggggaaaatttgctggttcagccagagggctggatggacagtgtttgctgagtcacagatatctctctcatgtagcctttgtctccacagtggtgaccaggaggcacagaacccaaacctggtatctcagctctgtggcgtctttcttcaaaatgagacgaatgaaaccatacatatgcagatgagcatggcagtgggacagcaggccctgcccttgaatatcattgcccccaaggctgtgctggtctccctctgtggggtcttattgaatggcactgtcttctggctgctttgctgtggggccacgaatccctacatggtatacatcctccacctggtcgctgctgacgtgatctatctttgctgctcggcagtggggttcttacaggtgactctgctaacttatcatggagtcgtgttttttatccctgatttcctggccatattgtctcccttctcctttgaggtgtgtctctgtctcctggtggccatcagcacagagcggtgtgtgtgtgtcctcttccccatctggtacagatgccaccgcccaaaatacacatctaatgttgtctgcaccctcatctggggcctgcctttttgcatcaacatagtaaaatcacttttcctaacttactggaaacatgtaaaggcatgtgtcatatttctaaagctttctgggctcttccatgctatcctttcacttgtgatgtgtgtgtcgagtctgactctactcattagattcctgtgctgctcccagcagcaaaaggccaccagggtctatgcggtggtgcagatctcggcccccatgttcctactctgggccctacccctgagcgtggcacccctcataacagatttcaaaatgtttgtcaccacctcctatttaatttccttgttcctcattataaacagcagcgccaaccctatcatttatttctttgtggggagcctcagaaagaaaaggctgaaggaatctctcagagtgattctccaacgggcgttagcagataagccagaggtggggaggaacaaaaaggcagctggcatcgacccaatggagcaaccacactctactcagcatgtggagaaccttcttcccagggagcacagggtcgatgtggaaacataa
Sequence Length
1137
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,411 Da
NCBI Official Full Name
Homo sapiens MAS1 oncogene-like, mRNA
NCBI Official Synonym Full Names
MAS1 proto-oncogene like, G protein-coupled receptor
NCBI Official Symbol
MAS1L
NCBI Official Synonym Symbols
MRG; MAS-L; dJ994E9.2
NCBI Protein Information
mas-related G-protein coupled receptor MRG
UniProt Protein Name
Mas-related G-protein coupled receptor MRG
UniProt Gene Name
MAS1L
UniProt Synonym Gene Names
MRG; MAS-R
UniProt Entry Name
MAS1L_HUMAN

Uniprot Description

MAS1L: Belongs to the G-protein coupled receptor 1 family. Mas subfamily.

Protein type: Membrane protein, multi-pass; GPCR, family 1; Membrane protein, integral; Receptor, GPCR

Chromosomal Location of Human Ortholog: 6p22.1

Cellular Component: cytoplasm; integral to plasma membrane; nucleoplasm; plasma membrane

Molecular Function: G-protein coupled receptor activity

Research Articles on MAS1L

Similar Products

Product Notes

The MAS1L mas1l (Catalog #AAA1274931) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtctggg ggaaaatttg ctggttcagc cagagggctg gatggacagt gtttgctgag tcacagatat ctctctcatg tagcctttgt ctccacagtg gtgaccagga ggcacagaac ccaaacctgg tatctcagct ctgtggcgtc tttcttcaaa atgagacgaa tgaaaccata catatgcaga tgagcatggc agtgggacag caggccctgc ccttgaatat cattgccccc aaggctgtgc tggtctccct ctgtggggtc ttattgaatg gcactgtctt ctggctgctt tgctgtgggg ccacgaatcc ctacatggta tacatcctcc acctggtcgc tgctgacgtg atctatcttt gctgctcggc agtggggttc ttacaggtga ctctgctaac ttatcatgga gtcgtgtttt ttatccctga tttcctggcc atattgtctc ccttctcctt tgaggtgtgt ctctgtctcc tggtggccat cagcacagag cggtgtgtgt gtgtcctctt ccccatctgg tacagatgcc accgcccaaa atacacatct aatgttgtct gcaccctcat ctggggcctg cctttttgca tcaacatagt aaaatcactt ttcctaactt actggaaaca tgtaaaggca tgtgtcatat ttctaaagct ttctgggctc ttccatgcta tcctttcact tgtgatgtgt gtgtcgagtc tgactctact cattagattc ctgtgctgct cccagcagca aaaggccacc agggtctatg cggtggtgca gatctcggcc cccatgttcc tactctgggc cctacccctg agcgtggcac ccctcataac agatttcaaa atgtttgtca ccacctccta tttaatttcc ttgttcctca ttataaacag cagcgccaac cctatcattt atttctttgt ggggagcctc agaaagaaaa ggctgaagga atctctcaga gtgattctcc aacgggcgtt agcagataag ccagaggtgg ggaggaacaa aaaggcagct ggcatcgacc caatggagca accacactct actcagcatg tggagaacct tcttcccagg gagcacaggg tcgatgtgga aacataa. It is sometimes possible for the material contained within the vial of "MAS1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.