Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPAG7 cdna clone

SPAG7 cDNA Clone

Gene Names
SPAG7; ACRP; FSA-1
Synonyms
SPAG7; SPAG7 cDNA Clone; SPAG7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacctactgggctccatcctgagctccatggagaagccacccagcctcggtgaccaggagactcggcgcaaggcccgagaacaggccgcccgcctgaagaaactacaagagcaagagaaacaacagaaagtggagtttcgtaaaaggatggagaaggaggtgtcagatttcattcaagacagtgggcagatcaagaaaaagtttcagccaatgaacaagatcgagaggagcatactacatgatgtggtggaagtggctggcctgacatccttctcctttggggaagatgatgactgtcgctatgtcatgatcttcaaaaaggagtttgcaccctcagatgaagagctagactcttaccgtcgtggagaggaatgggacccccagaaggctgaggagaagcggaagctgaaggagctggcccagaggcaagaggaggaggcagcccagcaggggcctgtggtggtgagccctgccagcgactacaaggacaagtacagccacctcatcggcaagggagcagccaaagacgcagcccacatgctacaggccaataagacctacggctgtgtgcccgtggccaataagagggacacacgctccattgaagaggctatgaatgagatcagagccaagaagcgtctgcggcagagtggggaagagttgccgccaacctcctag
Sequence Length
684
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,034 Da
NCBI Official Full Name
Homo sapiens sperm associated antigen 7, mRNA
NCBI Official Synonym Full Names
sperm associated antigen 7
NCBI Official Symbol
SPAG7
NCBI Official Synonym Symbols
ACRP; FSA-1
NCBI Protein Information
sperm-associated antigen 7
UniProt Protein Name
Sperm-associated antigen 7
Protein Family
UniProt Gene Name
SPAG7
UniProt Entry Name
SPAG7_HUMAN

Uniprot Description

SPAG7:

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 17p13.2

Research Articles on SPAG7

Similar Products

Product Notes

The SPAG7 spag7 (Catalog #AAA1274780) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacc tactgggctc catcctgagc tccatggaga agccacccag cctcggtgac caggagactc ggcgcaaggc ccgagaacag gccgcccgcc tgaagaaact acaagagcaa gagaaacaac agaaagtgga gtttcgtaaa aggatggaga aggaggtgtc agatttcatt caagacagtg ggcagatcaa gaaaaagttt cagccaatga acaagatcga gaggagcata ctacatgatg tggtggaagt ggctggcctg acatccttct cctttgggga agatgatgac tgtcgctatg tcatgatctt caaaaaggag tttgcaccct cagatgaaga gctagactct taccgtcgtg gagaggaatg ggacccccag aaggctgagg agaagcggaa gctgaaggag ctggcccaga ggcaagagga ggaggcagcc cagcaggggc ctgtggtggt gagccctgcc agcgactaca aggacaagta cagccacctc atcggcaagg gagcagccaa agacgcagcc cacatgctac aggccaataa gacctacggc tgtgtgcccg tggccaataa gagggacaca cgctccattg aagaggctat gaatgagatc agagccaaga agcgtctgcg gcagagtggg gaagagttgc cgccaacctc ctag. It is sometimes possible for the material contained within the vial of "SPAG7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.