Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERO1LB cdna clone

ERO1LB cDNA Clone

Gene Names
ERO1B; ERO1LB; Ero1beta
Synonyms
ERO1LB; ERO1LB cDNA Clone; ERO1LB cdna clone
Ordering
For Research Use Only!
Sequence
atgagccaaggggtccgccgggcaggcgctgggcagggggtagcggccgcggtgcagctgctggtcaccctgagcttcctgcggagcgtcgtcgaggcgcaggtcactggagttctggatgattgcttgtgtgatattgacagcatcgataacttcaatacctacaaaatcttccccaaaataaaaaaattgcaagagagagactattttcgttattacaaggttaatctgaagcgaccttgtcctttctgggcagaagatggccactgttcaataaaagactgtcatgtggagccctgtccagagagtaaaattccggttggaataaaagctgggcattctaataagtacttgaaaatggcaaacaataccaaagaattagaagtttgtgagcaagctaataaactgggagcaattaacagcacattaagtaatcaaagcaaagaagctttcattgactgggcaagatatgatgattcacgggatcacttttgtgaacttgatgatgagagatctccagctgctcagtatgtagacctattgctgaacccagagcgttacactggctataaagggacctctgcatggagagtgtggaacagcatctatgaagagaactgtttcaagcctcgatctgtttatcgtcctttaaatcctctggcgcctagccgaggcgaagatgatggagaatcattctacacatggctagaaggtttgtgtctggagaaaagagtcttctataagcttatatcgggacttcatgctagcatcaatttacatctatgcgcaaattatcttttggaagaaacctggggtaagcccagttggggacctaatattaaagaattcaaacaccgctttgaccctgtggaaaccaagggagaaggtccaagaaggctcaagaatctttactttttatacttgattgagcttcgagctttgtcaaaggtggctccatattttgagcgctcaattgtcgatctttacactggaaatgcagaagaagatgctgacacaaaaactcttctactgaatatctttcaagatacaaagtcctttcccatgcactttgatgagaaatccatgtttgcaggtgacaaaaaaggggccaagtcactaaaggaggaattccgattacatttcaagaatatctcccgtataatggactgtgttggatgtgacaaatgcagattatggggaaaattacagactcagggtttaggaactgccctgaagatattattctctgaaaaagaaatccaaaagcttccagagaatagtccatctaaaggcttccaactcacccgacaggaaatagttgctcttttaaatgcttttggaaggctttctacaagtataagagacttacagaattttaaagtcttattacaacacagtaggtaa
Sequence Length
1404
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,096 Da
NCBI Official Full Name
Homo sapiens ERO1-like beta (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
endoplasmic reticulum oxidoreductase 1 beta
NCBI Official Symbol
ERO1B
NCBI Official Synonym Symbols
ERO1LB; Ero1beta
NCBI Protein Information
ERO1-like protein beta
UniProt Protein Name
ERO1-like protein beta
UniProt Gene Name
ERO1B
UniProt Synonym Gene Names
ERO1-L-beta
UniProt Entry Name
ERO1B_HUMAN

Uniprot Description

ERO1LB: Essential oxidoreductase that oxidizes proteins in the endoplasmic reticulum to produce disulfide bonds. Acts by oxidizing directly P4HB/PDI isomerase through a direct disulfide exchange. Does not act as a direct oxidant of folding substrate, but relies on P4HB/PDI to transfer oxidizing equivalent. Associates with ERP44 but not with GRP54, demonstrating that it does not oxidize all PDI related proteins and can discriminate between PDI and related proteins. Its reoxidation probably involves electron transfer to molecular oxygen via FAD. Acts independently of glutathione. May be responsible for a significant proportion of reactive oxygen species (ROS) in the being a source of oxidative stress. Required for the folding of cell, thereby being a source of oxidative stress. Belongs to the EROs family.

Protein type: EC 1.8.4.-; Endoplasmic reticulum; Oxidoreductase

Chromosomal Location of Human Ortholog: 1q42.2-q43

Cellular Component: endoplasmic reticulum

Molecular Function: protein binding

Biological Process: protein folding

Research Articles on ERO1LB

Similar Products

Product Notes

The ERO1LB ero1b (Catalog #AAA1274743) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccaag gggtccgccg ggcaggcgct gggcaggggg tagcggccgc ggtgcagctg ctggtcaccc tgagcttcct gcggagcgtc gtcgaggcgc aggtcactgg agttctggat gattgcttgt gtgatattga cagcatcgat aacttcaata cctacaaaat cttccccaaa ataaaaaaat tgcaagagag agactatttt cgttattaca aggttaatct gaagcgacct tgtcctttct gggcagaaga tggccactgt tcaataaaag actgtcatgt ggagccctgt ccagagagta aaattccggt tggaataaaa gctgggcatt ctaataagta cttgaaaatg gcaaacaata ccaaagaatt agaagtttgt gagcaagcta ataaactggg agcaattaac agcacattaa gtaatcaaag caaagaagct ttcattgact gggcaagata tgatgattca cgggatcact tttgtgaact tgatgatgag agatctccag ctgctcagta tgtagaccta ttgctgaacc cagagcgtta cactggctat aaagggacct ctgcatggag agtgtggaac agcatctatg aagagaactg tttcaagcct cgatctgttt atcgtccttt aaatcctctg gcgcctagcc gaggcgaaga tgatggagaa tcattctaca catggctaga aggtttgtgt ctggagaaaa gagtcttcta taagcttata tcgggacttc atgctagcat caatttacat ctatgcgcaa attatctttt ggaagaaacc tggggtaagc ccagttgggg acctaatatt aaagaattca aacaccgctt tgaccctgtg gaaaccaagg gagaaggtcc aagaaggctc aagaatcttt actttttata cttgattgag cttcgagctt tgtcaaaggt ggctccatat tttgagcgct caattgtcga tctttacact ggaaatgcag aagaagatgc tgacacaaaa actcttctac tgaatatctt tcaagataca aagtcctttc ccatgcactt tgatgagaaa tccatgtttg caggtgacaa aaaaggggcc aagtcactaa aggaggaatt ccgattacat ttcaagaata tctcccgtat aatggactgt gttggatgtg acaaatgcag attatgggga aaattacaga ctcagggttt aggaactgcc ctgaagatat tattctctga aaaagaaatc caaaagcttc cagagaatag tccatctaaa ggcttccaac tcacccgaca ggaaatagtt gctcttttaa atgcttttgg aaggctttct acaagtataa gagacttaca gaattttaaa gtcttattac aacacagtag gtaa. It is sometimes possible for the material contained within the vial of "ERO1LB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.