SYT14L cdna clone
SYT14L cDNA Clone
Gene Names
SYT14P1; SYT14L; SYTDEP; CHR415SYT
Synonyms
SYT14L; SYT14L cDNA Clone; SYT14L cdna clone
Sequence
atgtcttgtagtgaaagtacatccgcatgtcagtctctcgaagacgggtcagttccagaaattctcattagcctgctttataatgccacaaatgggagactatcagcagaagtgataaaaggcagccacttaaaaaattgggcagcaaacagaccacccaatacatatgttaagttaactctacggaaatccacggatcaagagatgtccaaatgcaagatatccatccgcagagggcggccaaatccagtatacaaggaaacttttgttttcaaagtgaccctatttcagctttctcatgtgacactcatgctgtctgtgtataacaaaagcagcatgagaagaaagatgataggctggatttatttaggtctcaacagctctggagaagaactcaatcactggactgaaatgaaagagtcaaaaggacggcaagtacgtagatggcaggcgttgctagagtcacgatga
Sequence Length
471
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,436 Da
NCBI Official Full Name
Homo sapiens synaptotagmin XIV-like, mRNA
NCBI Official Synonym Full Names
synaptotagmin 14 pseudogene 1
NCBI Official Symbol
SYT14P1
NCBI Official Synonym Symbols
SYT14L; SYTDEP; CHR415SYT
UniProt Protein Name
Putative synaptotagmin-14-like protein
UniProt Gene Name
SYT14P1
UniProt Entry Name
SY14L_HUMAN
Uniprot Description
Plays a role in melanocyte differentiation; enhances dendrite outgrowth, melanin content and tyrosinase activity through the modulation of ERK and/or CREB pathways (PubMed:23999003).
Research Articles on SYT14L
Similar Products
Product Notes
The SYT14L syt14p1 (Catalog #AAA1274731) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttgta gtgaaagtac atccgcatgt cagtctctcg aagacgggtc agttccagaa attctcatta gcctgcttta taatgccaca aatgggagac tatcagcaga agtgataaaa ggcagccact taaaaaattg ggcagcaaac agaccaccca atacatatgt taagttaact ctacggaaat ccacggatca agagatgtcc aaatgcaaga tatccatccg cagagggcgg ccaaatccag tatacaagga aacttttgtt ttcaaagtga ccctatttca gctttctcat gtgacactca tgctgtctgt gtataacaaa agcagcatga gaagaaagat gataggctgg atttatttag gtctcaacag ctctggagaa gaactcaatc actggactga aatgaaagag tcaaaaggac ggcaagtacg tagatggcag gcgttgctag agtcacgatg a. It is sometimes possible for the material contained within the vial of "SYT14L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
