ZNF22 cdna clone
ZNF22 cDNA Clone
Gene Names
ZNF22; KOX15; HKR-T1; ZNF422; Zfp422
Synonyms
ZNF22; ZNF22 cDNA Clone; ZNF22 cdna clone
Sequence
atgaggttagcaaagcctaaagcgggtatttctcggagctcaagccaaggaaaggcctatgagaacaagcgcaaaacaggccggcagcggcagaagtggggcatgactattcgatttgactcaagcttcagtagactcagaagaagcttggatgacaaaccctataaatgtactgaatgtgaaaagagtttcagtcagagttcaactctttttcaacaccagaagatccatactggaaagaaatcccataaatgtgctgattgtgggaaaagtttctttcagagttctaatctcattcagcatcgacggatccatacgggggaaaagccctacaaatgtgatgagtgtggagaaagcttcaaacagagctcaaatctcattcagcaccagagaattcatactggagaaaaaccctatcagtgtgatgagtgtggccggtgtttcagccagagctcccaccttattcaacatcagagaacccacactggggagaaaccctaccagtgcagtgaatgtggcaaatgtttcagtcagagctctcatctgaggcagcacatgaaggtgcataaagaagagaagcctcgtaaaacccggggcaaaaatatcagggtgaagactcacttaccctcttggaaagctggtacaggaaggaagtctgtggctggtctccgttaa
Sequence Length
675
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,915 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 22 (KOX 15), mRNA
NCBI Official Synonym Full Names
zinc finger protein 22
NCBI Official Symbol
ZNF22
NCBI Official Synonym Symbols
KOX15; HKR-T1; ZNF422; Zfp422
NCBI Protein Information
zinc finger protein 22
UniProt Protein Name
Zinc finger protein 22
Protein Family
UniProt Gene Name
ZNF22
UniProt Synonym Gene Names
KOX15; KROX26
UniProt Entry Name
ZNF22_HUMAN
Uniprot Description
ZNF22: Binds DNA through the consensus sequence 5'-CAATG-3'. May be involved in transcriptional regulation and may play a role in tooth formation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: DNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 10q11
Cellular Component: nucleoplasm; nucleus
Molecular Function: DNA binding; zinc ion binding
Similar Products
Product Notes
The ZNF22 znf22 (Catalog #AAA1274658) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggttag caaagcctaa agcgggtatt tctcggagct caagccaagg aaaggcctat gagaacaagc gcaaaacagg ccggcagcgg cagaagtggg gcatgactat tcgatttgac tcaagcttca gtagactcag aagaagcttg gatgacaaac cctataaatg tactgaatgt gaaaagagtt tcagtcagag ttcaactctt tttcaacacc agaagatcca tactggaaag aaatcccata aatgtgctga ttgtgggaaa agtttctttc agagttctaa tctcattcag catcgacgga tccatacggg ggaaaagccc tacaaatgtg atgagtgtgg agaaagcttc aaacagagct caaatctcat tcagcaccag agaattcata ctggagaaaa accctatcag tgtgatgagt gtggccggtg tttcagccag agctcccacc ttattcaaca tcagagaacc cacactgggg agaaacccta ccagtgcagt gaatgtggca aatgtttcag tcagagctct catctgaggc agcacatgaa ggtgcataaa gaagagaagc ctcgtaaaac ccggggcaaa aatatcaggg tgaagactca cttaccctct tggaaagctg gtacaggaag gaagtctgtg gctggtctcc gttaa. It is sometimes possible for the material contained within the vial of "ZNF22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
