NHLRC2 cdna clone
NHLRC2 cDNA Clone
Synonyms
NHLRC2; NHLRC2 cDNA Clone; NHLRC2 cdna clone
Sequence
atggcagggactcatcagatatgggcactcctgctggactctggcaaactgccaaagaaaaatgagttaacaaaaggaacctgccttaggtttgctggaagtggaaatgaagagaatcgaaacaatgcctatcctcacaaggcaggttttgcccaaccttcaggcctttccttggcctctgaagatccctggagctgcttgtttgtagcagatagtgagagcagtacagtgagaaccgtttcactgaaagatggagcagtgaagcacctcgtaggaggagaaagagaccccatgaatttatttgcttttggtgatgttgatggagtaggaatcaatgcaaagcttcaacacccccttggagtaacatgggacaaaaaaaggaatttactttatgttgcagactcctacaatcacaagattaaagttgtggatccaaaaacaaaaaactgtacaacattagcaggaactggagacacaaataatgttaccagttccagttttacagagtcaacttttaatgaaccaggaggcttgtgtattggagagaatggagaattattatatgtagcagacaccaataatcatcaaattaaagtgatggatttagaaactaaaatggtatctgtgctccccatcttcagatctgaaaatgctgtggtagatggcccgttcctagtagaaaaacagaagacattacccaaactacctaaatctgctccaagcattaggctttcccccgtgactgcgtgtgctggccagactcttcagttcaaactcagattagacctcccatcaggatcaaagctaactgaaggagtatccagttgctggtttctaacagctgaaggcaatgaatggctacttcaaggacagatagcagctggagatatagagaacatttccagtcaaccaacaatttcactacaaattcctgatgattgcttatcacttgaagccattgtatctgtcagtgtgtttctttattactgtagtgcagacagcagtgcttgtatgatgaaggcaattttgttcagtcagcctttacaaataacggatacacagcaaggttgcatagctccagtagagctcaggtatgtattttag
Sequence Length
1104
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,697 Da
NCBI Official Full Name
Homo sapiens NHL repeat containing 2, mRNA
NCBI Official Synonym Full Names
NHL repeat containing 2
NCBI Official Symbol
NHLRC2
NCBI Protein Information
NHL repeat-containing protein 2
UniProt Protein Name
NHL repeat-containing protein 2
Protein Family
UniProt Gene Name
NHLRC2
UniProt Entry Name
NHLC2_HUMAN
Uniprot Description
NHLRC2: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 10q25.3
Molecular Function: protein binding
Research Articles on NHLRC2
Similar Products
Product Notes
The NHLRC2 nhlrc2 (Catalog #AAA1274627) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggga ctcatcagat atgggcactc ctgctggact ctggcaaact gccaaagaaa aatgagttaa caaaaggaac ctgccttagg tttgctggaa gtggaaatga agagaatcga aacaatgcct atcctcacaa ggcaggtttt gcccaacctt caggcctttc cttggcctct gaagatccct ggagctgctt gtttgtagca gatagtgaga gcagtacagt gagaaccgtt tcactgaaag atggagcagt gaagcacctc gtaggaggag aaagagaccc catgaattta tttgcttttg gtgatgttga tggagtagga atcaatgcaa agcttcaaca cccccttgga gtaacatggg acaaaaaaag gaatttactt tatgttgcag actcctacaa tcacaagatt aaagttgtgg atccaaaaac aaaaaactgt acaacattag caggaactgg agacacaaat aatgttacca gttccagttt tacagagtca acttttaatg aaccaggagg cttgtgtatt ggagagaatg gagaattatt atatgtagca gacaccaata atcatcaaat taaagtgatg gatttagaaa ctaaaatggt atctgtgctc cccatcttca gatctgaaaa tgctgtggta gatggcccgt tcctagtaga aaaacagaag acattaccca aactacctaa atctgctcca agcattaggc tttcccccgt gactgcgtgt gctggccaga ctcttcagtt caaactcaga ttagacctcc catcaggatc aaagctaact gaaggagtat ccagttgctg gtttctaaca gctgaaggca atgaatggct acttcaagga cagatagcag ctggagatat agagaacatt tccagtcaac caacaatttc actacaaatt cctgatgatt gcttatcact tgaagccatt gtatctgtca gtgtgtttct ttattactgt agtgcagaca gcagtgcttg tatgatgaag gcaattttgt tcagtcagcc tttacaaata acggatacac agcaaggttg catagctcca gtagagctca ggtatgtatt ttag. It is sometimes possible for the material contained within the vial of "NHLRC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
