Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX47 cdna clone

DDX47 cDNA Clone

Gene Names
DDX47; RRP3; E4-DBP; HQ0256; MSTP162
Synonyms
DDX47; DDX47 cDNA Clone; DDX47 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcaatctttggcccttgcaaaaaaaccacatataataatagcaactcctggtcgactgattgaccacttggaaaatacgaaaggtttcaacttgagagctctcaaatacttggtcatggatgaagccgaccgaatactgaatatggattttgagacagaggttgacaagatcctcaaagtgattcctcgagatcggaaaacattcctcttctctgccaccatgaccaagaaggttcaaaaacttcagcgagcagctctgaagaatcctgtgaaatgtgccgtttcctctaaataccagacagttgaaaaattacagcaatattatatttttattccctctaaattcaaggatacctacctggtttatattctaaatgaattggctggaaactcctttatgatattctgcagcacctgtaataatacccagagaacagctttgctactgcgaaatcttggcttcactgccatccccctccatggacaaatgagtcagagtaagcgcctaggatcccttaataagtttaaggccaaggcccgttccattcttctagcaactgacgttgccagccgaggtttggacatacctcatgtagatgtggttgtcaactttgacattcctacccattccaaggattacatccatcgagtaggtcgaacagctagagctgggcgctccggaaaggctattacttttgtcacacagtatgatgtggaactcttccagcgcatagaacacttaattgggaagaaactaccaggttttccaacacaggatgatgaggttatgatgctgacagaacgcgtcgctgaagcccaaaggtttgcccgaatggagttaagggagcatggagaaaagaagaaacgctcgcgagaggatgctggagataatgatgacacagagggtgctattggtgtcaggaacaaggtggctggaggaaaaatgaagaagcggaaaggccgttaa
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,169 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 47, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 47
NCBI Official Symbol
DDX47
NCBI Official Synonym Symbols
RRP3; E4-DBP; HQ0256; MSTP162
NCBI Protein Information
probable ATP-dependent RNA helicase DDX47
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX47
UniProt Gene Name
DDX47
UniProt Entry Name
DDX47_HUMAN

NCBI Description

This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX47: a protein of the DEAD box helicase family. Unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp, are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly.

Protein type: Helicase; EC 3.6.4.13; RNA-binding; Nucleolus

Chromosomal Location of Human Ortholog: 12p13.1

Cellular Component: membrane; nucleolus; nucleoplasm

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: induction of apoptosis via death domain receptors; RNA secondary structure unwinding; RNA splicing; rRNA processing

Research Articles on DDX47

Similar Products

Product Notes

The DDX47 ddx47 (Catalog #AAA1274615) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcaat ctttggccct tgcaaaaaaa ccacatataa taatagcaac tcctggtcga ctgattgacc acttggaaaa tacgaaaggt ttcaacttga gagctctcaa atacttggtc atggatgaag ccgaccgaat actgaatatg gattttgaga cagaggttga caagatcctc aaagtgattc ctcgagatcg gaaaacattc ctcttctctg ccaccatgac caagaaggtt caaaaacttc agcgagcagc tctgaagaat cctgtgaaat gtgccgtttc ctctaaatac cagacagttg aaaaattaca gcaatattat atttttattc cctctaaatt caaggatacc tacctggttt atattctaaa tgaattggct ggaaactcct ttatgatatt ctgcagcacc tgtaataata cccagagaac agctttgcta ctgcgaaatc ttggcttcac tgccatcccc ctccatggac aaatgagtca gagtaagcgc ctaggatccc ttaataagtt taaggccaag gcccgttcca ttcttctagc aactgacgtt gccagccgag gtttggacat acctcatgta gatgtggttg tcaactttga cattcctacc cattccaagg attacatcca tcgagtaggt cgaacagcta gagctgggcg ctccggaaag gctattactt ttgtcacaca gtatgatgtg gaactcttcc agcgcataga acacttaatt gggaagaaac taccaggttt tccaacacag gatgatgagg ttatgatgct gacagaacgc gtcgctgaag cccaaaggtt tgcccgaatg gagttaaggg agcatggaga aaagaagaaa cgctcgcgag aggatgctgg agataatgat gacacagagg gtgctattgg tgtcaggaac aaggtggctg gaggaaaaat gaagaagcgg aaaggccgtt aa. It is sometimes possible for the material contained within the vial of "DDX47, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.