Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF15 cdna clone

PHF15 cDNA Clone

Gene Names
JADE2; PHF15; JADE-2
Synonyms
PHF15; PHF15 cDNA Clone; PHF15 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagagaagaggcgaaaatactccatcagcagtgacaactctgacaccactgacagtcatgcgacatctacatccgcatcaagatgctccaaactgcccagcagcaccaagtcgggctggccccgacagaacgaaaagaagccctccgaggttttccggacagacttgatcacagccatgaagatcccggactcataccagctcagcccggatgactactacatcctggcagacccatggcgacaggaatgggagaaaggtgtgcaggtgcctgccggggcagaggccatcccagagcccgtggtgaggatcctcccaccactggaaggcccccctgcccaggcatccccgagcagcaccatgcttggtgagggctcccagcctgattggccagggggcagccgctatgacttggacgagattgatgcctactggctggagctcatcaactcggagcttaaggagatggagaggccggagctggacgagctgacattagagcgtgtgctggaggagctggagaccctgtgccaccagaatatggccagggccattgagacgcaggaggggctgggcatcgagtacgacgaggatgttgtctgcgacgtgtgtcgctctcctgagggcgaggatggcaacgagatggtcttctgtgacaagtgcaacgtctgtgtgcatcaggcatgctacgggatcctcaaggtgcccacgggcagctggctgtgccggacgtgtgccctgggtgtccagccaaagtgcctgctctgccccaagcgaggaggagccttgaagcccactagaagtgggaccaagtgggtgcatgtcagctgtgccctatggattcctgaggtcagcatcggctgcccagagaagatggagcccatcaccaagatctcgcatatcccagccagccgctgggctctgtcctgcagcctctgcaaggaatgcacaggcacctgcatccagtgttccatgccttcctgcgtcacagcgttccatgtcacatgcgcctttgaccacggcctggaaatgcggactatattagcagacaacgatgaggtcaagttcaagtcattctgccaggagcacagtgacgggggcccacgtaatgagcccacatctgagcccacggaacccagccaggctggcgaggacctggaaaaggtgaccctgcgcaagcagcggctgcagcagctagaggaggacttctacgagctggtggagccggctgaggtggctgagcggctggacctggctgaggcactggtcgacttcatctaccagtactggaagctgaagaggaaagccaatgccaaccagccgctgctgacccccaagaccgacgaggtggacaacctggcccagcaggagcaggacgtcctctaccgccgcctgaagctcttcacccatctgcggcaggacctagagagggttagaaatctgtgctacatggtgacaaggcgcgagagaacgaaacacgccatctgcaaactccaggagcagatattccacctgcagatgaaacttattgaacaggatctgtgtcgagcaggcctgtccacctcattccccatcgatggcaccttcttcaacagctggctggcacagtcggtgcagatcacagcagagaacatggccatgagcgagtggccactgaacaatgggcaccgcgaggaccctgctccagggctgctgtcagaggaactgctgcaggacgaggagacactgctcagcttcatgcgggacccctcgctgcgacctggtgaccctgctaggaaggcccgaggccgcacccgcctgcctgccaagaagaaaccaccaccaccaccaccgcaggacgggcctggttcacggacgactccagacaaagcccccaagaagacctggggccaggatgcaggcagtggcaaggggggtcaagggccacctaccaggaagccaccacgtcggacatcttctcacttgccgtccagccctgcagccggggactgtcccatcctagccacccctgaaagccccccgccactggcccctgagaccccggacgaggcagcctcagtagctgctgactcagatgtccaagtgcctggccctgcagcaagccctaagcctttgggccggctccggccaccccgcgagagcaaggtaacccggagattgccgggtgccaggcctgatgctgggatgggaccaccttcagctgtggctgagaggcccaaggtcagcctgcattttgacactgagactgatggctacttctctgatggggagatgagcgactcagatgtagaggccgaggacggtggggtgcagcggggtccccgggaggcaggggcagaggaggtggtccgcatgggcgtactggcctcctaa
Sequence Length
2376
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,466 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 15, mRNA
NCBI Official Synonym Full Names
jade family PHD finger 2
NCBI Official Symbol
JADE2
NCBI Official Synonym Symbols
PHF15; JADE-2
NCBI Protein Information
protein Jade-2
UniProt Protein Name
Protein Jade-2
UniProt Gene Name
JADE2
UniProt Synonym Gene Names
KIAA0239; PHF15
UniProt Entry Name
JADE2_HUMAN

Uniprot Description

JADE2: Component of the HBO1 complex which has a histone H4- specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Belongs to the JADE family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: histone acetyltransferase complex; nucleoplasm

Molecular Function: protein binding

Similar Products

Product Notes

The PHF15 jade2 (Catalog #AAA1274494) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaga agaggcgaaa atactccatc agcagtgaca actctgacac cactgacagt catgcgacat ctacatccgc atcaagatgc tccaaactgc ccagcagcac caagtcgggc tggccccgac agaacgaaaa gaagccctcc gaggttttcc ggacagactt gatcacagcc atgaagatcc cggactcata ccagctcagc ccggatgact actacatcct ggcagaccca tggcgacagg aatgggagaa aggtgtgcag gtgcctgccg gggcagaggc catcccagag cccgtggtga ggatcctccc accactggaa ggcccccctg cccaggcatc cccgagcagc accatgcttg gtgagggctc ccagcctgat tggccagggg gcagccgcta tgacttggac gagattgatg cctactggct ggagctcatc aactcggagc ttaaggagat ggagaggccg gagctggacg agctgacatt agagcgtgtg ctggaggagc tggagaccct gtgccaccag aatatggcca gggccattga gacgcaggag gggctgggca tcgagtacga cgaggatgtt gtctgcgacg tgtgtcgctc tcctgagggc gaggatggca acgagatggt cttctgtgac aagtgcaacg tctgtgtgca tcaggcatgc tacgggatcc tcaaggtgcc cacgggcagc tggctgtgcc ggacgtgtgc cctgggtgtc cagccaaagt gcctgctctg ccccaagcga ggaggagcct tgaagcccac tagaagtggg accaagtggg tgcatgtcag ctgtgcccta tggattcctg aggtcagcat cggctgccca gagaagatgg agcccatcac caagatctcg catatcccag ccagccgctg ggctctgtcc tgcagcctct gcaaggaatg cacaggcacc tgcatccagt gttccatgcc ttcctgcgtc acagcgttcc atgtcacatg cgcctttgac cacggcctgg aaatgcggac tatattagca gacaacgatg aggtcaagtt caagtcattc tgccaggagc acagtgacgg gggcccacgt aatgagccca catctgagcc cacggaaccc agccaggctg gcgaggacct ggaaaaggtg accctgcgca agcagcggct gcagcagcta gaggaggact tctacgagct ggtggagccg gctgaggtgg ctgagcggct ggacctggct gaggcactgg tcgacttcat ctaccagtac tggaagctga agaggaaagc caatgccaac cagccgctgc tgacccccaa gaccgacgag gtggacaacc tggcccagca ggagcaggac gtcctctacc gccgcctgaa gctcttcacc catctgcggc aggacctaga gagggttaga aatctgtgct acatggtgac aaggcgcgag agaacgaaac acgccatctg caaactccag gagcagatat tccacctgca gatgaaactt attgaacagg atctgtgtcg agcaggcctg tccacctcat tccccatcga tggcaccttc ttcaacagct ggctggcaca gtcggtgcag atcacagcag agaacatggc catgagcgag tggccactga acaatgggca ccgcgaggac cctgctccag ggctgctgtc agaggaactg ctgcaggacg aggagacact gctcagcttc atgcgggacc cctcgctgcg acctggtgac cctgctagga aggcccgagg ccgcacccgc ctgcctgcca agaagaaacc accaccacca ccaccgcagg acgggcctgg ttcacggacg actccagaca aagcccccaa gaagacctgg ggccaggatg caggcagtgg caaggggggt caagggccac ctaccaggaa gccaccacgt cggacatctt ctcacttgcc gtccagccct gcagccgggg actgtcccat cctagccacc cctgaaagcc ccccgccact ggcccctgag accccggacg aggcagcctc agtagctgct gactcagatg tccaagtgcc tggccctgca gcaagcccta agcctttggg ccggctccgg ccaccccgcg agagcaaggt aacccggaga ttgccgggtg ccaggcctga tgctgggatg ggaccacctt cagctgtggc tgagaggccc aaggtcagcc tgcattttga cactgagact gatggctact tctctgatgg ggagatgagc gactcagatg tagaggccga ggacggtggg gtgcagcggg gtccccggga ggcaggggca gaggaggtgg tccgcatggg cgtactggcc tcctaa. It is sometimes possible for the material contained within the vial of "PHF15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.