Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIRREL2 cdna clone

KIRREL2 cDNA Clone

Gene Names
KIRREL2; NLG1; NEPH3; FILTRIN
Synonyms
KIRREL2; KIRREL2 cDNA Clone; KIRREL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcaggatgcgggtccccgccctcctcgtcctcctcttctgcttcagagggagagcaggcccgtcgccccatttcctgcaacagccagaggacctggtggtgctgctgggcgagggaggtgcccaggccagcctgggccgtagagcctcagcctctttctccgagcaaaagaacctgatgcgaatccctggcagcagcgacggctccagttcacgaggtcctgaagaagaggagacaggcagccgcgaggaccggggccccattgtgcacactgaccacagtgatctggttctggaggaggaagggactctggagaccaaggacccaaccaacggttactacaaggtccgaggagtcagtgtgagcctgagccttggcgaagcccctggaggaggtctcttcctgccaccaccctccccccttgggcccccagggacccctaccttctatgacttcaacccacacctgggcatggtccccccctgcagactttacagagccagggcaggctatctcaccacaccccaccctcgagctttcaccagctacatcaaacccacatcctttgggcccccagatctggcccccgggactccccccttcccatatgctgccttccccacacctagccacccgcgtctccagactcacgtgtga
Sequence Length
660
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,583 Da
NCBI Official Full Name
Homo sapiens kin of IRRE like 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
kin of IRRE like 2 (Drosophila)
NCBI Official Symbol
KIRREL2
NCBI Official Synonym Symbols
NLG1; NEPH3; FILTRIN
NCBI Protein Information
kin of IRRE-like protein 2
UniProt Protein Name
Kin of IRRE-like protein 2
Protein Family
UniProt Gene Name
KIRREL2
UniProt Synonym Gene Names
NEPH3
UniProt Entry Name
KIRR2_HUMAN

NCBI Description

This gene encodes a type I transmembrane protein and member of the immunoglobulin superfamily of cell adhesion molecules. The encoded protein localizes to adherens junctions in pancreatic beta cells and regulates insulin secretion. Autoantibodies against the encoded protein have been detected in serum from patients with type 1 diabetes. This gene may also play a role in glomerular development and decreased expression of this gene has been observed in human glomerular diseases. This gene and the related opposite-strand gene nephrin (GeneID: 527362) are regulated by a bidirectional promoter. [provided by RefSeq, Jul 2016]

Uniprot Description

KIRREL2: Belongs to the immunoglobulin superfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Cell adhesion

Chromosomal Location of Human Ortholog: 19q13.12

Cellular Component: plasma membrane

Molecular Function: protein binding

Research Articles on KIRREL2

Similar Products

Product Notes

The KIRREL2 kirrel2 (Catalog #AAA1274455) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcagga tgcgggtccc cgccctcctc gtcctcctct tctgcttcag agggagagca ggcccgtcgc cccatttcct gcaacagcca gaggacctgg tggtgctgct gggcgaggga ggtgcccagg ccagcctggg ccgtagagcc tcagcctctt tctccgagca aaagaacctg atgcgaatcc ctggcagcag cgacggctcc agttcacgag gtcctgaaga agaggagaca ggcagccgcg aggaccgggg ccccattgtg cacactgacc acagtgatct ggttctggag gaggaaggga ctctggagac caaggaccca accaacggtt actacaaggt ccgaggagtc agtgtgagcc tgagccttgg cgaagcccct ggaggaggtc tcttcctgcc accaccctcc ccccttgggc ccccagggac ccctaccttc tatgacttca acccacacct gggcatggtc cccccctgca gactttacag agccagggca ggctatctca ccacacccca ccctcgagct ttcaccagct acatcaaacc cacatccttt gggcccccag atctggcccc cgggactccc cccttcccat atgctgcctt ccccacacct agccacccgc gtctccagac tcacgtgtga. It is sometimes possible for the material contained within the vial of "KIRREL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.