Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C20orf7 cdna clone

C20orf7 cDNA Clone

Gene Names
NDUFAF5; C20orf7; dJ842G6.1; bA526K24.2
Synonyms
C20orf7; C20orf7 cDNA Clone; C20orf7 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcggccggcagggctctggcgcttatgtcggcgaccttgggcggcgagggtcccagcggagaatcttggccgtagggaagtcacctctggtgtctctccccgcggtagcacctcgcccagaaccctgaatattttcgaccgggatttgaaaaggaaacagaagaactgggcagcccggcagcccgagccgaccaaatttgactacctgaaggaggaggttggaagtcggatcgcagaccgtgtatatgacatacccagaaatttcccccttgctttggatcttggttgtggaagaggttacattgcacaatatttgaataagcttcagttattccattgcaggaaactattggaaagtttttccaagctgacattgcagaaaatgctttgtttgcattgggtgaatgaccttcctagagcacttgagcagattcattatattttaaaaccagatggagtgtttatcggtgcaatgtttggaggcgacacactctatgaacttcggtgttccttacagttagcggaaacggaaagggaaggaggattttctccacacatttctcctttcactgctgtcaatgacctgggacatctgcttgggagagctggctttaatactctgactgtggacactgatgaaattcaagttaactatcctggaatgtttgaattgatggaagatttacaaggtatgggtgagagtaactgtgcttggaatagaaaagccctgctgcatcgagacacaatgctggcagctgcggcagtgtacagagaaatgtacagaaatgaagatggttcagtacctgctacataccagatctattacatgataggatggaaatatcatgagtcacaggcaagaccagctgaaagaggttccgcaactgtgtcatttggagagctaggaaaaataaacaaccttatgccaccggggaaaaaatcacaataa
Sequence Length
954
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,076 Da
NCBI Official Full Name
Homo sapiens chromosome 20 open reading frame 7, mRNA
NCBI Official Synonym Full Names
NADH:ubiquinone oxidoreductase complex assembly factor 5
NCBI Official Symbol
NDUFAF5
NCBI Official Synonym Symbols
C20orf7; dJ842G6.1; bA526K24.2
NCBI Protein Information
NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 5
UniProt Protein Name
NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 5
UniProt Gene Name
NDUFAF5
UniProt Synonym Gene Names
C20orf7
UniProt Entry Name
NDUF5_HUMAN

NCBI Description

The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

NDUFAF5: Involved in the assembly of mitochondrial NADH:ubiquinone oxidoreductase complex (complex I, MT-ND1) at early stages. May have methyltransferase activity. Defects in NDUFAF5 are a cause of mitochondrial complex I deficiency (MT-C1D). A disorder of the mitochondrial respiratory chain that causes a wide range of clinical disorders, from lethal neonatal disease to adult-onset neurodegenerative disorders. Phenotypes include macrocephaly with progressive leukodystrophy, non-specific encephalopathy, cardiomyopathy, myopathy, liver disease, Leigh syndrome, Leber hereditary optic neuropathy, and some forms of Parkinson disease. Defects in NDUFAF5 are a cause of Leigh syndrome (LS). An early-onset progressive neurodegenerative disorder characterized by the presence of focal, bilateral lesions in one or more areas of the central nervous system including the brainstem, thalamus, basal ganglia, cerebellum and spinal cord. Clinical features depend on which areas of the central nervous system are involved and include subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, and dysphagia. Belongs to the methyltransferase superfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; Mitochondrial; EC 2.1.1.-

Chromosomal Location of Human Ortholog: 20p12.1

Cellular Component: mitochondrial inner membrane

Biological Process: mitochondrial respiratory chain complex I assembly

Disease: Mitochondrial Complex I Deficiency

Research Articles on C20orf7

Similar Products

Product Notes

The C20orf7 ndufaf5 (Catalog #AAA1274415) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcggc cggcagggct ctggcgctta tgtcggcgac cttgggcggc gagggtccca gcggagaatc ttggccgtag ggaagtcacc tctggtgtct ctccccgcgg tagcacctcg cccagaaccc tgaatatttt cgaccgggat ttgaaaagga aacagaagaa ctgggcagcc cggcagcccg agccgaccaa atttgactac ctgaaggagg aggttggaag tcggatcgca gaccgtgtat atgacatacc cagaaatttc ccccttgctt tggatcttgg ttgtggaaga ggttacattg cacaatattt gaataagctt cagttattcc attgcaggaa actattggaa agtttttcca agctgacatt gcagaaaatg ctttgtttgc attgggtgaa tgaccttcct agagcacttg agcagattca ttatatttta aaaccagatg gagtgtttat cggtgcaatg tttggaggcg acacactcta tgaacttcgg tgttccttac agttagcgga aacggaaagg gaaggaggat tttctccaca catttctcct ttcactgctg tcaatgacct gggacatctg cttgggagag ctggctttaa tactctgact gtggacactg atgaaattca agttaactat cctggaatgt ttgaattgat ggaagattta caaggtatgg gtgagagtaa ctgtgcttgg aatagaaaag ccctgctgca tcgagacaca atgctggcag ctgcggcagt gtacagagaa atgtacagaa atgaagatgg ttcagtacct gctacatacc agatctatta catgatagga tggaaatatc atgagtcaca ggcaagacca gctgaaagag gttccgcaac tgtgtcattt ggagagctag gaaaaataaa caaccttatg ccaccgggga aaaaatcaca ataa. It is sometimes possible for the material contained within the vial of "C20orf7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.