Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM176A cdna clone

FAM176A cDNA Clone

Synonyms
FAM176A; FAM176A cDNA Clone; FAM176A cdna clone
Ordering
For Research Use Only!
Sequence
atgaggctgcccctcagccacagcccagagcacgtggagatggctttgctcagcaacatcctagcggcctattcctttgtctcagaaaatcctgagcgagcagctctgtactttgtttctggcgtgtgcatcgggctggtgctgaccctggctgctctggtgataaggatctcttgccacacagactgcaggcggcgtcccgggaagaagttcctgcaggacagagagagcagcagcgacagcagcgacagcgaggatggcagtgaggacaccgtgtccgatctctccgtgcggagacaccgccgcttcgagaggactttgaacaagaatgtgttcacctctgcggaggagctggagcgcgcccagcggctggaggagcgcgagcgcatcatcagggagatctggatgaatggccagcctgaggtgcccgggaccaggagcctgaatcgctactattag
Sequence Length
459
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,470 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 176, member A, mRNA
UniProt Protein Name
Protein eva-1 homolog A
UniProt Gene Name
EVA1A
UniProt Synonym Gene Names
FAM176A; TMEM166
UniProt Entry Name
EVA1A_HUMAN

Uniprot Description

TMEM166: Acts as a regulator of programmed cell death, mediating both autophagy and apoptosis. Belongs to the FAM176 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2p12

Cellular Component: intracellular membrane-bound organelle; plasma membrane

Similar Products

Product Notes

The FAM176A eva1a (Catalog #AAA1274414) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggctgc ccctcagcca cagcccagag cacgtggaga tggctttgct cagcaacatc ctagcggcct attcctttgt ctcagaaaat cctgagcgag cagctctgta ctttgtttct ggcgtgtgca tcgggctggt gctgaccctg gctgctctgg tgataaggat ctcttgccac acagactgca ggcggcgtcc cgggaagaag ttcctgcagg acagagagag cagcagcgac agcagcgaca gcgaggatgg cagtgaggac accgtgtccg atctctccgt gcggagacac cgccgcttcg agaggacttt gaacaagaat gtgttcacct ctgcggagga gctggagcgc gcccagcggc tggaggagcg cgagcgcatc atcagggaga tctggatgaa tggccagcct gaggtgcccg ggaccaggag cctgaatcgc tactattag. It is sometimes possible for the material contained within the vial of "FAM176A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.