Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CNFN cdna clone

CNFN cDNA Clone

Gene Names
CNFN; PLAC8L2
Synonyms
CNFN; CNFN cDNA Clone; CNFN cdna clone
Ordering
For Research Use Only!
Sequence
ATGTCCTACCCTGTGACCAGTCAGCCCCAGTGCGCCACCACCAGCTGCTACCAGACCCAGCTCAGTGACTGGCACACAGGTCTCACGGACTGCTGCAACGACATGCCTGTCTGTCTGTGCGGCACTTTTGCTCCTCTGTGCCTTGCCTGCCGCATCTCCGACGACTTTGGCGAGTGCTGCTGCGCGCCCTACCTGCCCGGAGGCCTGCACTCCATCCGCACCGGCATGCGGGAGCGCTACCACATCCAGGGCTCCGTCGGGCACGACTGGGCGGCCCTCACCTTTTGTCTGCCCTGCGCCCTCTGCCAGATGGCGCGGGAACTGAAGATCCGAGAGTAA
Sequence Length
339
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,376 Da
NCBI Official Full Name
Homo sapiens cornifelin, mRNA
NCBI Official Synonym Full Names
cornifelin
NCBI Official Symbol
CNFN
NCBI Official Synonym Symbols
PLAC8L2
NCBI Protein Information
cornifelin
UniProt Protein Name
Cornifelin
Protein Family
UniProt Gene Name
CNFN
UniProt Entry Name
CNFN_HUMAN

Uniprot Description

CNFN: Part of the insoluble cornified cell envelope (CE) of stratified squamous epithelia. Belongs to the cornifelin family.

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: cornified envelope

Similar Products

Product Notes

The CNFN cnfn (Catalog #AAA1274405) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTCCTACC CTGTGACCAG TCAGCCCCAG TGCGCCACCA CCAGCTGCTA CCAGACCCAG CTCAGTGACT GGCACACAGG TCTCACGGAC TGCTGCAACG ACATGCCTGT CTGTCTGTGC GGCACTTTTG CTCCTCTGTG CCTTGCCTGC CGCATCTCCG ACGACTTTGG CGAGTGCTGC TGCGCGCCCT ACCTGCCCGG AGGCCTGCAC TCCATCCGCA CCGGCATGCG GGAGCGCTAC CACATCCAGG GCTCCGTCGG GCACGACTGG GCGGCCCTCA CCTTTTGTCT GCCCTGCGCC CTCTGCCAGA TGGCGCGGGA ACTGAAGATC CGAGAGTAA. It is sometimes possible for the material contained within the vial of "CNFN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.