Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ST3GAL2 cdna clone

ST3GAL2 cDNA Clone

Gene Names
ST3GAL2; SIAT4B; ST3GALII; Gal-NAc6S; ST3GalA.2
Synonyms
ST3GAL2; ST3GAL2 cDNA Clone; ST3GAL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgctccctgcgggtgtggttcctctccgtggccttcctgctggtgttcatcatgtccctgctcttcacctactcgcaccacagcatggccacgctcccctacctggactcaggggccctggatgggacgcaccgggtgaagctggtgcccggctatgccggcctgcagcgcctcagcaaggagaggctctcgggcaagagctgtgcctgtcgccgctgcatgggcgatgccggtgcctccgactggtttgacagccactttgacggtaacatttcccccgtctggacccgagagaacatggatcttccaccggacgtccagaggtggtggatgatgctgcagccccagttcaagtcacacaacaccaatgaggtgctggagaagctgttccagatagtgcctggcgagaacccctaccgcttccgggacccccaccagtgccggcgctgtgccgtggtggggaactcgggcaacctgcggggctctggctatgggcaggacgtggacgggcacaacttcatcatgaggatgaatcaggcgccaaccgtgggctttgagcaggatgttggcagccgaaccacccaccatttcatgtaccctgagagtgccaagaacctgcccgccaacgtcagcttcgtgctggtgcccttcaaggtcctggaccttctgtggatcgccagcgccttgtccacggggcagatccgattcacctacgccccagtgaagtccttccttcgagtggataaagaaaaggtccagatctacaacccagccttcttcaagtatatccacgacaggtggacagagcatcacgggcggtacccttccacggggatgctggtgcttttctttgccctgcatgtgtgtgatgaggtgaacgtgtacgggttcggggccgacagccggggcaactggcaccactactgggagaacaaccggtacgcgggcgagttccggaagactggcgtgcacgacgcggacttcgaggcccacatcatcgacatgctggccaaggccagcaagatcgaagtctaccggggcaactga
Sequence Length
1053
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,173 Da
NCBI Official Full Name
Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 2, mRNA
NCBI Official Synonym Full Names
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
NCBI Official Symbol
ST3GAL2
NCBI Official Synonym Symbols
SIAT4B; ST3GALII; Gal-NAc6S; ST3GalA.2
NCBI Protein Information
CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 2
UniProt Protein Name
CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 2
UniProt Gene Name
ST3GAL2
UniProt Synonym Gene Names
SIAT4B; Alpha 2,3-ST 2; Beta-galactoside alpha-2,3-sialyltransferase 2; ST3GalII; SIAT4-B
UniProt Entry Name
SIA4B_HUMAN

NCBI Description

The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4A. [provided by RefSeq, Jul 2008]

Uniprot Description

ST3GAL2: It may be responsible for the synthesis of the sequence NeuAc-alpha-2,3-Gal-beta-1,3-GalNAc- found in terminal carbohydrate groups of certain glycoproteins, oligosaccharides and glycolipids. SIAT4A and SIAT4B sialylate the same acceptor substrates but exhibit different Km values. Belongs to the glycosyltransferase 29 family.

Protein type: Transferase; Glycan Metabolism - keratan sulfate biosynthesis; Glycan Metabolism - O-glycan biosynthesis; EC 2.4.99.4; Membrane protein, integral; Glycan Metabolism - glycosphingolipid biosynthesis - globo series; Glycan Metabolism - glycosphingolipid biosynthesis - ganglio series

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: Golgi membrane

Molecular Function: beta-galactoside alpha-2,3-sialyltransferase activity

Biological Process: amino sugar metabolic process; ganglioside biosynthetic process; keratan sulfate biosynthetic process; O-glycan processing; oligosaccharide metabolic process; protein amino acid N-linked glycosylation via asparagine; protein modification process

Research Articles on ST3GAL2

Similar Products

Product Notes

The ST3GAL2 st3gal2 (Catalog #AAA1274392) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtgct ccctgcgggt gtggttcctc tccgtggcct tcctgctggt gttcatcatg tccctgctct tcacctactc gcaccacagc atggccacgc tcccctacct ggactcaggg gccctggatg ggacgcaccg ggtgaagctg gtgcccggct atgccggcct gcagcgcctc agcaaggaga ggctctcggg caagagctgt gcctgtcgcc gctgcatggg cgatgccggt gcctccgact ggtttgacag ccactttgac ggtaacattt cccccgtctg gacccgagag aacatggatc ttccaccgga cgtccagagg tggtggatga tgctgcagcc ccagttcaag tcacacaaca ccaatgaggt gctggagaag ctgttccaga tagtgcctgg cgagaacccc taccgcttcc gggaccccca ccagtgccgg cgctgtgccg tggtggggaa ctcgggcaac ctgcggggct ctggctatgg gcaggacgtg gacgggcaca acttcatcat gaggatgaat caggcgccaa ccgtgggctt tgagcaggat gttggcagcc gaaccaccca ccatttcatg taccctgaga gtgccaagaa cctgcccgcc aacgtcagct tcgtgctggt gcccttcaag gtcctggacc ttctgtggat cgccagcgcc ttgtccacgg ggcagatccg attcacctac gccccagtga agtccttcct tcgagtggat aaagaaaagg tccagatcta caacccagcc ttcttcaagt atatccacga caggtggaca gagcatcacg ggcggtaccc ttccacgggg atgctggtgc ttttctttgc cctgcatgtg tgtgatgagg tgaacgtgta cgggttcggg gccgacagcc ggggcaactg gcaccactac tgggagaaca accggtacgc gggcgagttc cggaagactg gcgtgcacga cgcggacttc gaggcccaca tcatcgacat gctggccaag gccagcaaga tcgaagtcta ccggggcaac tga. It is sometimes possible for the material contained within the vial of "ST3GAL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.