Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RXFP1 cdna clone

RXFP1 cDNA Clone

Gene Names
RXFP1; LGR7; RXFPR1
Synonyms
RXFP1; RXFP1 cDNA Clone; RXFP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgacatctggttctgtcttcttctacatcttaatttttggaaaatatttttctcatgggggtggacaggatgtcaagtgctcccttggctatttcccctgtgggaacatcacaaagtgcttgcctcagctcctgcactgtaacggtgtggacgactgcgggaatcaggccgatgaggacaactgtggagacaacaatggatggtctctgcaatttgacaaatattttgccagttactacaaaatgacttcccaatatccttttgaggcagaaacacctgaatgtttggtcggttctgtgccagtgcaatgtctttgccaaggtctggagcttgactgtgatgaaaccaatttacgagctgttccatcggtttcttcaaatgtgactgcaatgtcacttcagtggaacttaataagaaagcttcctcctgattgcttcaagaattatcatgatcttcagaagctgtacctgcaaaacaataagattacatccatctccatctatgctttcagaggactgaatagccttactaaactgtatctcagtcataacagaataaccttcctgaagccgggtgtttttgaagatcttcacagactagaatggctgataattgaagataatcacctcagtcgaatttccccaccaacattttatggactaaattctcttattctcttagtcctgatgaataacgtcctcacccgtttacctgataaacctctctgtcaacacatgccaagactacattggctggaccttgaaggcaaccatatccataatttaagaaatttgacttttatttcctgcagtaatttaactgttttagtgatgaggaaaaacaaaattaatcacttaaatgaaaatacttttgcacctctccagaaactggatgaattggatttaggaagtaataagattgaaaatcttccaccgcttatattcaaggacctgaaggagctgtcacaattgaatctttcctataatccaatccagaaaattcaagcaaaccaatttgattatcttgtcaaactcaagtctctcagcctagaagggattgaaatttcaaatatccaacaaaggatgtttagacctcttatgaatctctctcacatatattttaagaaattccagtactgtgggtatgcaccacatgttcgcagctgtaaaccaaacactgatggaatttcatctctagagaatctcttggcaagcattattcagagagtatttgtctgggttgtatctgcagttacctgctttggaaacatttttgtcatttgcatgcgaccttatatcaggtctgagaacaagctgtatgccatgtcaatcatttctctctgctgtgccgactgcttaatgggaatatatttattcgtgatcggaggctttgacctaaagtttcgtggagaatacaataagcatgcgcagctgtggatggagagtactcattgtcagcttgtaggatctttggccattctgtccacagaagtatcagttttactgttaacatttctgacattggaaaaatacatctgcattgtctatccttttagatgtgtgagacctggaaaatgcagaacaattacagttctgattctcatttggattactggttttatagtggctttcattccattgagcaataaggaatttttcaaaaactactatggcaccaatggagtatgcttccctcttcattcagaagatacagaaagtattggagcccagatttattcagtggcaatttttcttggtattaatttggccgcatttatcatcatagttttttcctatggaagcatgttttatagtgttcatcaaagtgccataacagcaactgaaatacggaatcaagttaaaaaagagatgatccttgccaaacgttttttctttatagtatttactgatgcattatgctggatacccatttttgtagtgaaatttctttcactgcttcaggtagaaataccaggtaccataacctcttgggtagtgatttttattctgcccattaacagtgctttgaacccaattctctatactctgaccacaagaccatttaaagaaatgattcatcggttttggtataactacagacaaagaaaatctatggacagcaaaggtcagaaaacatatgctccatcattcatctgggtggaaatgtggccactgcaggagatgccacctgagttaatgaagccggaccttttcacatacccctgtgaaatgtcactgatttctcaatcaacgagactcaattcctattcatga
Sequence Length
2274
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
75,272 Da
NCBI Official Full Name
Homo sapiens relaxin/insulin-like family peptide receptor 1, mRNA
NCBI Official Synonym Full Names
relaxin/insulin like family peptide receptor 1
NCBI Official Symbol
RXFP1
NCBI Official Synonym Symbols
LGR7; RXFPR1
NCBI Protein Information
relaxin receptor 1
UniProt Protein Name
Relaxin receptor 1
Protein Family
UniProt Gene Name
RXFP1
UniProt Synonym Gene Names
LGR7
UniProt Entry Name
RXFP1_HUMAN

NCBI Description

This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

RXFP1: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP. Belongs to the G-protein coupled receptor 1 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: GPCR, family 1; Receptor, GPCR; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 4q32.1

Cellular Component: plasma membrane

Molecular Function: G-protein coupled receptor activity; protein binding

Biological Process: G-protein signaling, coupled to cAMP nucleotide second messenger

Research Articles on RXFP1

Similar Products

Product Notes

The RXFP1 rxfp1 (Catalog #AAA1274302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacatctg gttctgtctt cttctacatc ttaatttttg gaaaatattt ttctcatggg ggtggacagg atgtcaagtg ctcccttggc tatttcccct gtgggaacat cacaaagtgc ttgcctcagc tcctgcactg taacggtgtg gacgactgcg ggaatcaggc cgatgaggac aactgtggag acaacaatgg atggtctctg caatttgaca aatattttgc cagttactac aaaatgactt cccaatatcc ttttgaggca gaaacacctg aatgtttggt cggttctgtg ccagtgcaat gtctttgcca aggtctggag cttgactgtg atgaaaccaa tttacgagct gttccatcgg tttcttcaaa tgtgactgca atgtcacttc agtggaactt aataagaaag cttcctcctg attgcttcaa gaattatcat gatcttcaga agctgtacct gcaaaacaat aagattacat ccatctccat ctatgctttc agaggactga atagccttac taaactgtat ctcagtcata acagaataac cttcctgaag ccgggtgttt ttgaagatct tcacagacta gaatggctga taattgaaga taatcacctc agtcgaattt ccccaccaac attttatgga ctaaattctc ttattctctt agtcctgatg aataacgtcc tcacccgttt acctgataaa cctctctgtc aacacatgcc aagactacat tggctggacc ttgaaggcaa ccatatccat aatttaagaa atttgacttt tatttcctgc agtaatttaa ctgttttagt gatgaggaaa aacaaaatta atcacttaaa tgaaaatact tttgcacctc tccagaaact ggatgaattg gatttaggaa gtaataagat tgaaaatctt ccaccgctta tattcaagga cctgaaggag ctgtcacaat tgaatctttc ctataatcca atccagaaaa ttcaagcaaa ccaatttgat tatcttgtca aactcaagtc tctcagccta gaagggattg aaatttcaaa tatccaacaa aggatgttta gacctcttat gaatctctct cacatatatt ttaagaaatt ccagtactgt gggtatgcac cacatgttcg cagctgtaaa ccaaacactg atggaatttc atctctagag aatctcttgg caagcattat tcagagagta tttgtctggg ttgtatctgc agttacctgc tttggaaaca tttttgtcat ttgcatgcga ccttatatca ggtctgagaa caagctgtat gccatgtcaa tcatttctct ctgctgtgcc gactgcttaa tgggaatata tttattcgtg atcggaggct ttgacctaaa gtttcgtgga gaatacaata agcatgcgca gctgtggatg gagagtactc attgtcagct tgtaggatct ttggccattc tgtccacaga agtatcagtt ttactgttaa catttctgac attggaaaaa tacatctgca ttgtctatcc ttttagatgt gtgagacctg gaaaatgcag aacaattaca gttctgattc tcatttggat tactggtttt atagtggctt tcattccatt gagcaataag gaatttttca aaaactacta tggcaccaat ggagtatgct tccctcttca ttcagaagat acagaaagta ttggagccca gatttattca gtggcaattt ttcttggtat taatttggcc gcatttatca tcatagtttt ttcctatgga agcatgtttt atagtgttca tcaaagtgcc ataacagcaa ctgaaatacg gaatcaagtt aaaaaagaga tgatccttgc caaacgtttt ttctttatag tatttactga tgcattatgc tggataccca tttttgtagt gaaatttctt tcactgcttc aggtagaaat accaggtacc ataacctctt gggtagtgat ttttattctg cccattaaca gtgctttgaa cccaattctc tatactctga ccacaagacc atttaaagaa atgattcatc ggttttggta taactacaga caaagaaaat ctatggacag caaaggtcag aaaacatatg ctccatcatt catctgggtg gaaatgtggc cactgcagga gatgccacct gagttaatga agccggacct tttcacatac ccctgtgaaa tgtcactgat ttctcaatca acgagactca attcctattc atga. It is sometimes possible for the material contained within the vial of "RXFP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.