Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SRC cdna clone

SRC cDNA Clone

Gene Names
SRC; ASV; SRC1; THC6; c-SRC; p60-Src
Synonyms
SRC; SRC cDNA Clone; SRC cdna clone
Ordering
For Research Use Only!
Sequence
atgggtagcaacaagagcaagcccaaggatgccagccagcggcgccgcagcctggagcccgccgagaacgtgcacggcgctggcgggggcgctttccccgcctcgcagacccccagcaagccagcctcggccgacggccaccgcggccccagcgcggccttcgcccccgcggccgccgagcccaagctgttcggaggcttcaactcctcggacaccgtcacctccccgcagagggcgggcccgctggccggtggagtgaccacctttgtggccctctatgactatgagtctaggacggagacagacctgtccttcaagaaaggcgagcggctccagattgtcaacaacacagagggagactggtggctggcccactcgctcagcacaggacagacaggctacatccccagcaactacgtggcgccctccgactccatccaggctgaggagtggtattttggcaagatcaccagacgggagtcagagcggttactgctcaatgcagagaacccgagagggaccttcctcgtgcgagaaagtgagaccacgaaaggtgcctactgcctctcagtgtctgacttcgacaacgccaagggcctcaacgtgaagcactacaagatccgcaagctggacagcggcggcttctacatcacctcccgcacccagttcaacagcctgcagcagctggtggcctactactccaaacacgccgatggcctgtgccaccgcctcaccaccgtgtgccccacgtccaagccgcagactcagggcctggccaaggatgcctgggagatccctcgggagtcgctgcggctggaggtcaagctgggccagggctgctttggcgaggtgtggatggggacctggaacggtaccaccagggtggccatcaaaaccctgaagcctggcacgatgtctccagaggccttcctgcaggaggcccaggtcatgaagaagctgaggcatgagaagctggtgcagttgtatgctgtggtttcagaggagcccatttacatcgtcacggagtacatgagcaaggggagtttgctggactttctcaagggggagacaggcaagtacctgcggctgcctcagctggtggacatggctgctcagatcgcctcaggcatggcgtacgtggagcggatgaactacgtccaccgggaccttcgtgcagccaacatcctggtgggagagaacctggtgtgcaaagtggccgactttgggctggctcggctcattgaagacaatgagtacacggcgcggcaaggtgccaaattccccatcaagtggacggctccagaagctgccctctatggccgcttcaccatcaagtcggacgtgtggtccttcgggatcctgctgactgagctcaccacaaagggacgggtgccctaccctgggatggtgaaccgcgaggtgctggaccaggtggagcggggctaccggatgccctgcccgccggagtgtcccgagtccctgcacgacctcatgtgccagtgctggcggaaggagcctgaggagcggcccaccttcgagtacctgcaggccttcctggaggactacttcacgtccaccgagccccagtaccagcccggggagaacctctag
Sequence Length
1611
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,589 Da
NCBI Official Full Name
Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian), mRNA
NCBI Official Synonym Full Names
SRC proto-oncogene, non-receptor tyrosine kinase
NCBI Official Symbol
SRC
NCBI Official Synonym Symbols
ASV; SRC1; THC6; c-SRC; p60-Src
NCBI Protein Information
proto-oncogene tyrosine-protein kinase Src
UniProt Protein Name
Proto-oncogene tyrosine-protein kinase Src
Protein Family
UniProt Gene Name
SRC
UniProt Synonym Gene Names
SRC1; p60-Src
UniProt Entry Name
SRC_HUMAN

NCBI Description

This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

Src: proto-oncogenic cytoplasmic tyrosine kinase of the SRC family. Highly expressed in certain fully differentiated cells such as neurons, platelets and macrophages. Phosphorylation of an activation loop tyrosine activates the enzyme; phosphorylation of a tyrosine in the C-terminus by Csk inhibits the enzyme. Two alternatively spliced isoforms have been described.

Protein type: Protein kinase, TK; Kinase, protein; Oncoprotein; EC 2.7.10.2; Protein kinase, tyrosine (non-receptor); TK group; Src family

Chromosomal Location of Human Ortholog: 20q12-q13

Cellular Component: caveola; cell-cell adherens junction; cytoplasm; cytosol; extrinsic to internal side of plasma membrane; late endosome; lysosome; mitochondrial inner membrane; mitochondrion; plasma membrane

Molecular Function: enzyme binding; ephrin receptor binding; heme binding; hormone receptor binding; integrin binding; kinase activity; kinase binding; non-membrane spanning protein tyrosine kinase activity; phosphoprotein binding; protein binding; protein kinase activity; protein-tyrosine kinase activity; receptor binding; SH2 domain binding; SH3/SH2 adaptor activity

Biological Process: bone resorption; central nervous system development; ephrin receptor signaling pathway; epidermal growth factor receptor signaling pathway; estrogen receptor signaling pathway; innate immune response; integrin-mediated signaling pathway; leukocyte migration; negative regulation of apoptosis; negative regulation of caspase activity; negative regulation of focal adhesion formation; negative regulation of mitochondrial depolarization; negative regulation of protein homooligomerization; negative regulation of telomerase activity; negative regulation of telomere maintenance via telomerase; peptidyl-tyrosine phosphorylation; platelet activation; platelet-derived growth factor receptor signaling pathway; positive regulation of integrin activation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of protein kinase B signaling cascade; positive regulation of small GTPase mediated signal transduction; progesterone receptor signaling pathway; protein amino acid autophosphorylation; regulation of bone resorption; regulation of cell cycle; regulation of cell proliferation; regulation of cell-cell adhesion; regulation of vascular permeability; signal complex assembly; signal transduction; stimulatory C-type lectin receptor signaling pathway; stress fiber formation; T cell costimulation; transforming growth factor beta receptor signaling pathway; vascular endothelial growth factor receptor signaling pathway

Disease: Colorectal Cancer; Thrombocytopenia 6

Research Articles on SRC

Similar Products

Product Notes

The SRC src (Catalog #AAA1274281) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtagca acaagagcaa gcccaaggat gccagccagc ggcgccgcag cctggagccc gccgagaacg tgcacggcgc tggcgggggc gctttccccg cctcgcagac ccccagcaag ccagcctcgg ccgacggcca ccgcggcccc agcgcggcct tcgcccccgc ggccgccgag cccaagctgt tcggaggctt caactcctcg gacaccgtca cctccccgca gagggcgggc ccgctggccg gtggagtgac cacctttgtg gccctctatg actatgagtc taggacggag acagacctgt ccttcaagaa aggcgagcgg ctccagattg tcaacaacac agagggagac tggtggctgg cccactcgct cagcacagga cagacaggct acatccccag caactacgtg gcgccctccg actccatcca ggctgaggag tggtattttg gcaagatcac cagacgggag tcagagcggt tactgctcaa tgcagagaac ccgagaggga ccttcctcgt gcgagaaagt gagaccacga aaggtgccta ctgcctctca gtgtctgact tcgacaacgc caagggcctc aacgtgaagc actacaagat ccgcaagctg gacagcggcg gcttctacat cacctcccgc acccagttca acagcctgca gcagctggtg gcctactact ccaaacacgc cgatggcctg tgccaccgcc tcaccaccgt gtgccccacg tccaagccgc agactcaggg cctggccaag gatgcctggg agatccctcg ggagtcgctg cggctggagg tcaagctggg ccagggctgc tttggcgagg tgtggatggg gacctggaac ggtaccacca gggtggccat caaaaccctg aagcctggca cgatgtctcc agaggccttc ctgcaggagg cccaggtcat gaagaagctg aggcatgaga agctggtgca gttgtatgct gtggtttcag aggagcccat ttacatcgtc acggagtaca tgagcaaggg gagtttgctg gactttctca agggggagac aggcaagtac ctgcggctgc ctcagctggt ggacatggct gctcagatcg cctcaggcat ggcgtacgtg gagcggatga actacgtcca ccgggacctt cgtgcagcca acatcctggt gggagagaac ctggtgtgca aagtggccga ctttgggctg gctcggctca ttgaagacaa tgagtacacg gcgcggcaag gtgccaaatt ccccatcaag tggacggctc cagaagctgc cctctatggc cgcttcacca tcaagtcgga cgtgtggtcc ttcgggatcc tgctgactga gctcaccaca aagggacggg tgccctaccc tgggatggtg aaccgcgagg tgctggacca ggtggagcgg ggctaccgga tgccctgccc gccggagtgt cccgagtccc tgcacgacct catgtgccag tgctggcgga aggagcctga ggagcggccc accttcgagt acctgcaggc cttcctggag gactacttca cgtccaccga gccccagtac cagcccgggg agaacctcta g. It is sometimes possible for the material contained within the vial of "SRC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.