Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHRNB1 cdna clone

CHRNB1 cDNA Clone

Gene Names
CHRNB1; ACHRB; CHRNB; CMS1D; CMS2A; CMS2C; SCCMS
Synonyms
CHRNB1; CHRNB1 cDNA Clone; CHRNB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccccaggggctctgctgatgctgctgggggcgctgggggcgccgctcgccccaggcgtccgcggctcggaggcggagggtcgactccgggagaaacttttctctggctatgatagctccgtgcggccagcgcgggaggtgggagaccgtgtcagggtcagcgttggtctcatcctggcgcaactcatcagcctgaacgagaaggatgaagagatgagcacaaaggtgtacttagacctggagtggactgactacaggctgagctgggaccctgcggagcacgacggcatcgattcgctccgcatcacggcggaatccgtgtggctccctgacgtggtgctactgaacaacaatgatgggaattttgacgtggctctggacattagcgtcgtggtgtcctccgacggctccgtgcgttggcaacccccgggcatctatcgcagcagctgcagcatccaggtcacctacttccccttcgactggcagaattgcactatggtgttcagctcctacagctacgacagctcggaggtcagcctgcagacaggcctgggtcctgacgggcaagggcatcaggaaatccacattcatgaagggactttcattgagaatggccagtgggagattatccacaagccctctcggctaatccagcctccaggcgatcctaggggagggagggaaggacagcgccaggaagtcatcttctacctcatcatccgccgcaagcctctcttctacctggtcaacgtcattgccccatgcatcctcatcactcttctggccatcttcgtcttctacctgccaccagatgcaggagagaagatggggctctcaatctttgccctgctgacccttactgtgttcctgctgctgctggctgacaaagtacctgagacctcactatcagtacccattattatcaagtacctcatgtttaccatggtcctcgtcaccttctcagtcatccttagtgtcgtggttctcaacctgcaccaccgctcaccccacacccaccaaatgcccctttgggtccgtcagatcttcattcacaaacttccgctgtacctgcgtctaaaaaggcccaaacccgagagagacctgatgccggagccccctcactgttcttctccaggaagtggctggggtcggggaacagatgaatatttcatccggaagccgccaagtgattttctcttccccaaacccaataggttccagcctgaactgtctgcccctgatctgcggcgatttatcgatggtccaaaccgggctgtggccctgcttccggagctacgggaggtcgtctcctctatcagctacatcgctcgacagctgcaggaacaggaggaccacgatgcgctgaaggaggactggcagtttgtggccatggtagtggaccgcctcttcctgtggactttcatcatcttcaccagcgttgggaccctagtcatcttcctggacgccacgtaccacttgccccctccagacccctttccttga
Sequence Length
1506
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,083 Da
NCBI Official Full Name
Homo sapiens cholinergic receptor, nicotinic, beta 1 (muscle), mRNA
NCBI Official Synonym Full Names
cholinergic receptor nicotinic beta 1 subunit
NCBI Official Symbol
CHRNB1
NCBI Official Synonym Symbols
ACHRB; CHRNB; CMS1D; CMS2A; CMS2C; SCCMS
NCBI Protein Information
acetylcholine receptor subunit beta
UniProt Protein Name
Acetylcholine receptor subunit beta
Protein Family
UniProt Gene Name
CHRNB1
UniProt Synonym Gene Names
ACHRB; CHRNB
UniProt Entry Name
ACHB_HUMAN

NCBI Description

The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]

Uniprot Description

nAChRB1: After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. Defects in CHRNB1 are a cause of congenital myasthenic syndrome slow-channel type (SCCMS). SCCMS is the most common congenital myasthenic syndrome. Congenital myasthenic syndromes are characterized by muscle weakness affecting the axial and limb muscles (with hypotonia in early-onset forms), the ocular muscles (leading to ptosis and ophthalmoplegia), and the facial and bulbar musculature (affecting sucking and swallowing, and leading to dysphonia). The symptoms fluctuate and worsen with physical effort. SCCMS is caused by kinetic abnormalities of the AChR, resulting in prolonged endplate currents and prolonged AChR channel opening episodes. Defects in CHRNB1 are a cause of congenital myasthenic syndrome with acetylcholine receptor deficiency (CMS-ACHRD). CMS-ACHRD is a postsynaptic congenital myasthenic syndrome. Mutations underlying AChR deficiency cause a 'loss of function' and show recessive inheritance. Belongs to the ligand-gated ion channel (TC 1.A.9) family. Acetylcholine receptor (TC 1.A.9.1) subfamily. Beta- 1/CHRNB1 sub-subfamily.

Protein type: Channel, ligand-gated; Membrane protein, multi-pass; Membrane protein, integral; Channel, cation

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: nicotinic acetylcholine-gated receptor-channel complex; synapse

Molecular Function: acetylcholine binding; acetylcholine receptor activity; channel activity; ligand-gated ion channel activity; nicotinic acetylcholine-activated cation-selective channel activity

Biological Process: behavioral response to nicotine; cation transport; muscle contraction; muscle fiber development; neurological system process; neuromuscular synaptic transmission; postsynaptic membrane organization; regulation of membrane potential; signal transduction; synaptic transmission, cholinergic

Disease: Myasthenic Syndrome, Congenital, 2a, Slow-channel; Myasthenic Syndrome, Congenital, 2c, Associated With Acetylcholine Receptor Deficiency

Research Articles on CHRNB1

Similar Products

Product Notes

The CHRNB1 chrnb1 (Catalog #AAA1274259) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccccag gggctctgct gatgctgctg ggggcgctgg gggcgccgct cgccccaggc gtccgcggct cggaggcgga gggtcgactc cgggagaaac ttttctctgg ctatgatagc tccgtgcggc cagcgcggga ggtgggagac cgtgtcaggg tcagcgttgg tctcatcctg gcgcaactca tcagcctgaa cgagaaggat gaagagatga gcacaaaggt gtacttagac ctggagtgga ctgactacag gctgagctgg gaccctgcgg agcacgacgg catcgattcg ctccgcatca cggcggaatc cgtgtggctc cctgacgtgg tgctactgaa caacaatgat gggaattttg acgtggctct ggacattagc gtcgtggtgt cctccgacgg ctccgtgcgt tggcaacccc cgggcatcta tcgcagcagc tgcagcatcc aggtcaccta cttccccttc gactggcaga attgcactat ggtgttcagc tcctacagct acgacagctc ggaggtcagc ctgcagacag gcctgggtcc tgacgggcaa gggcatcagg aaatccacat tcatgaaggg actttcattg agaatggcca gtgggagatt atccacaagc cctctcggct aatccagcct ccaggcgatc ctaggggagg gagggaagga cagcgccagg aagtcatctt ctacctcatc atccgccgca agcctctctt ctacctggtc aacgtcattg ccccatgcat cctcatcact cttctggcca tcttcgtctt ctacctgcca ccagatgcag gagagaagat ggggctctca atctttgccc tgctgaccct tactgtgttc ctgctgctgc tggctgacaa agtacctgag acctcactat cagtacccat tattatcaag tacctcatgt ttaccatggt cctcgtcacc ttctcagtca tccttagtgt cgtggttctc aacctgcacc accgctcacc ccacacccac caaatgcccc tttgggtccg tcagatcttc attcacaaac ttccgctgta cctgcgtcta aaaaggccca aacccgagag agacctgatg ccggagcccc ctcactgttc ttctccagga agtggctggg gtcggggaac agatgaatat ttcatccgga agccgccaag tgattttctc ttccccaaac ccaataggtt ccagcctgaa ctgtctgccc ctgatctgcg gcgatttatc gatggtccaa accgggctgt ggccctgctt ccggagctac gggaggtcgt ctcctctatc agctacatcg ctcgacagct gcaggaacag gaggaccacg atgcgctgaa ggaggactgg cagtttgtgg ccatggtagt ggaccgcctc ttcctgtgga ctttcatcat cttcaccagc gttgggaccc tagtcatctt cctggacgcc acgtaccact tgccccctcc agaccccttt ccttga. It is sometimes possible for the material contained within the vial of "CHRNB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.