RAB40B cdna clone
RAB40B cDNA Clone
Gene Names
RAB40B; RAR; SEC4L
Synonyms
RAB40B; RAB40B cDNA Clone; RAB40B cdna clone
Sequence
atgagcgccctgggcagcccggtccgggcctacgactttctgctcaagttcctgctggtgggcgacagcgacgtgggcaagggcgagatcctggcgagcctgcaggatggcgcggccgagtccacgtacggccacccggcgggcatcgactacaagacgaccaccatcctgctggacgggcggcgggtgaagctgcagctctgggatacttcaggccagggaagattttgtaccatattccgctcctactcccggggcgcacagggtgtgatcctggtctatgacattgcgaaccgctggtcttttgacggcattgatcgatggattaaggagatcgatgagcatgcccccggagtccccaagatcctggtggggaaccgcctgcacctggcgttcaagcggcaggtgcccacggagcaggcccaggcctacgccgagcgcctgggcgtgaccttctttgaggtcagccctctgtgcaatttcaacatcacagagtcgttcacggagctggccaggatcgtgctgctgcggcatgggatggaccggctctggcggccgagcaaggtgctgagcttgcaagacctctgctgccgggcggtcgtgtcctgcacgccggtgcacctggtggacaagctcccgctccccattgccttaagaagccacctcaagtccttctcgatggccaacggcctgaatgccaggatgatgcacggcggttcctactccctcaccaccagctccacccacaaaaggagcagcctccgcaaagtgaagctcgtccgccccccccagagcccccccaaaaactgcaccagaaacagctgcaaaatttcttaa
Sequence Length
837
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,956 Da
NCBI Official Full Name
Homo sapiens RAB40B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB40B, member RAS oncogene family
NCBI Official Symbol
RAB40B
NCBI Official Synonym Symbols
RAR; SEC4L
NCBI Protein Information
ras-related protein Rab-40B
UniProt Protein Name
Ras-related protein Rab-40B
Protein Family
UniProt Gene Name
RAB40B
UniProt Synonym Gene Names
SEC4L; Protein Rar
UniProt Entry Name
RB40B_HUMAN
NCBI Description
The protein encoded by this gene has similarity to a yeast protein which suggests a role of the gene product in regulating secretory vesicles. [provided by RefSeq, Jul 2008]
Uniprot Description
RAB40B: May be a substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Belongs to the small GTPase superfamily. Rab family.
Protein type: G protein; G protein, monomeric, Rab; G protein, monomeric
Chromosomal Location of Human Ortholog: 17q25.3
Cellular Component: nuclear envelope; perinuclear region of cytoplasm
Biological Process: intracellular protein transport in host
Research Articles on RAB40B
Similar Products
Product Notes
The RAB40B rab40b (Catalog #AAA1274252) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgccc tgggcagccc ggtccgggcc tacgactttc tgctcaagtt cctgctggtg ggcgacagcg acgtgggcaa gggcgagatc ctggcgagcc tgcaggatgg cgcggccgag tccacgtacg gccacccggc gggcatcgac tacaagacga ccaccatcct gctggacggg cggcgggtga agctgcagct ctgggatact tcaggccagg gaagattttg taccatattc cgctcctact cccggggcgc acagggtgtg atcctggtct atgacattgc gaaccgctgg tcttttgacg gcattgatcg atggattaag gagatcgatg agcatgcccc cggagtcccc aagatcctgg tggggaaccg cctgcacctg gcgttcaagc ggcaggtgcc cacggagcag gcccaggcct acgccgagcg cctgggcgtg accttctttg aggtcagccc tctgtgcaat ttcaacatca cagagtcgtt cacggagctg gccaggatcg tgctgctgcg gcatgggatg gaccggctct ggcggccgag caaggtgctg agcttgcaag acctctgctg ccgggcggtc gtgtcctgca cgccggtgca cctggtggac aagctcccgc tccccattgc cttaagaagc cacctcaagt ccttctcgat ggccaacggc ctgaatgcca ggatgatgca cggcggttcc tactccctca ccaccagctc cacccacaaa aggagcagcc tccgcaaagt gaagctcgtc cgcccccccc agagcccccc caaaaactgc accagaaaca gctgcaaaat ttcttaa. It is sometimes possible for the material contained within the vial of "RAB40B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
