Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHD2 cdna clone

CHD2 cDNA Clone

Gene Names
CHD2; EEOC
Synonyms
CHD2; CHD2 cDNA Clone; CHD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgagaaataaggacaaaagccaagaggaggacagttcgctacacagcaatgcatcgagtcactcagcctctgaagaagcttcgggttcagactcaggcagtcagtcggaaagtgagcagggaagtgatccaggaagtggacatggcagcgagtcgaacagcagctctgaatcttctgagagtcagtcggaatctgagagcgaatcagcaggttccaaatcccagccagtcctcccagaagccaaagagaagccagcctctaagaaggaacggatagctgatgtgaagaagatgtgggaagaatatcctgatgtttatggggtcaggcggtcaaaccgaagcagacaagaaccatcgcgatttaatattaaggaagaggcaagtagcgggtctgagagtgggagcccaaaaagaagaggccagaggcagctgaaaaaacaagaaaaatggaaacaggaaccctcagaagatgaacaggaacaaggcaccagtgcagagagtgagccagaacaaaaaaaagtaaaagccagaagacctgtccccagaagaacagtgcccaaacctcgtgttaaaaagcagccgaagactcagcgtggaaagagaaaaaagcaagattcttctgatgaggatgatgatgatgacgaagctcccaaaaggcagactcgtcgaagagcggctaaaaacgttagttacaaagaagatgatgactttgagactgactcagatgatctcattgaaatgactggagaaggagttgatgaacagcaagataatagtgaaactattgaaaaggtcttagattcaagactgggaaagaaaggagccactggagcatctactactgtatatgcgattgaagctaatggcgaccctagtggtgactttgacactgaaaaggatgaaggtgaaatccagtacctcatcaagtggaagggttggtcttacatccacagcacatgggagagtgaagaatccttacagcaacagaaagtgaagggcctaaaaaaactagagaacttcaagaaaaaagaggacgaaatcaaacaatggttagggaaagtttctcctgaagatgtagaatatttcaattgccaacaggagctggcttcagagttgaataaacagtatcagatagtagaaagagtaatagctgtgaagacaagtaaatctacattgggtcaaacagattttccagctcatagtcggaagccggcaccctcaaatgagcccgaatatctatgtaaatggatgggactcccctattcagagtgtagctgggaagatgaagccctcattggaaagaaattccagaattgcattgacagcttccacagtaggaacaactcaaaaaccatcccaacaagagaatgcaaggccctgaagcagagaccacgatttgtagctttaaagaaacaacctgcatatttaggaggggagaatctggaacttcgagattatcagctagaaggtctaaactggctagctcattcctggtgcaagtag
Sequence Length
1506
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,826 Da
NCBI Official Full Name
Homo sapiens chromodomain helicase DNA binding protein 2, mRNA
NCBI Official Synonym Full Names
chromodomain helicase DNA binding protein 2
NCBI Official Symbol
CHD2
NCBI Official Synonym Symbols
EEOC
NCBI Protein Information
chromodomain-helicase-DNA-binding protein 2
UniProt Protein Name
Chromodomain-helicase-DNA-binding protein 2
UniProt Gene Name
CHD2
UniProt Synonym Gene Names
CHD-2
UniProt Entry Name
CHD2_HUMAN

NCBI Description

The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CHD-2: Sequence-selective DNA-binding protein. Belongs to the SNF2/RAD54 helicase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; EC 3.6.4.12; Helicase

Chromosomal Location of Human Ortholog: 15q26

Cellular Component: intracellular membrane-bound organelle; nucleolus; nucleoplasm; nucleus

Molecular Function: ATP-dependent DNA helicase activity; DNA binding; histone binding; protein binding

Biological Process: muscle development; regulation of transcription from RNA polymerase II promoter

Disease: Epileptic Encephalopathy, Childhood-onset

Research Articles on CHD2

Similar Products

Product Notes

The CHD2 chd2 (Catalog #AAA1274180) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgagaa ataaggacaa aagccaagag gaggacagtt cgctacacag caatgcatcg agtcactcag cctctgaaga agcttcgggt tcagactcag gcagtcagtc ggaaagtgag cagggaagtg atccaggaag tggacatggc agcgagtcga acagcagctc tgaatcttct gagagtcagt cggaatctga gagcgaatca gcaggttcca aatcccagcc agtcctccca gaagccaaag agaagccagc ctctaagaag gaacggatag ctgatgtgaa gaagatgtgg gaagaatatc ctgatgttta tggggtcagg cggtcaaacc gaagcagaca agaaccatcg cgatttaata ttaaggaaga ggcaagtagc gggtctgaga gtgggagccc aaaaagaaga ggccagaggc agctgaaaaa acaagaaaaa tggaaacagg aaccctcaga agatgaacag gaacaaggca ccagtgcaga gagtgagcca gaacaaaaaa aagtaaaagc cagaagacct gtccccagaa gaacagtgcc caaacctcgt gttaaaaagc agccgaagac tcagcgtgga aagagaaaaa agcaagattc ttctgatgag gatgatgatg atgacgaagc tcccaaaagg cagactcgtc gaagagcggc taaaaacgtt agttacaaag aagatgatga ctttgagact gactcagatg atctcattga aatgactgga gaaggagttg atgaacagca agataatagt gaaactattg aaaaggtctt agattcaaga ctgggaaaga aaggagccac tggagcatct actactgtat atgcgattga agctaatggc gaccctagtg gtgactttga cactgaaaag gatgaaggtg aaatccagta cctcatcaag tggaagggtt ggtcttacat ccacagcaca tgggagagtg aagaatcctt acagcaacag aaagtgaagg gcctaaaaaa actagagaac ttcaagaaaa aagaggacga aatcaaacaa tggttaggga aagtttctcc tgaagatgta gaatatttca attgccaaca ggagctggct tcagagttga ataaacagta tcagatagta gaaagagtaa tagctgtgaa gacaagtaaa tctacattgg gtcaaacaga ttttccagct catagtcgga agccggcacc ctcaaatgag cccgaatatc tatgtaaatg gatgggactc ccctattcag agtgtagctg ggaagatgaa gccctcattg gaaagaaatt ccagaattgc attgacagct tccacagtag gaacaactca aaaaccatcc caacaagaga atgcaaggcc ctgaagcaga gaccacgatt tgtagcttta aagaaacaac ctgcatattt aggaggggag aatctggaac ttcgagatta tcagctagaa ggtctaaact ggctagctca ttcctggtgc aagtag. It is sometimes possible for the material contained within the vial of "CHD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.