HHAT cdna clone
HHAT cDNA Clone
Gene Names
HHAT; Skn; SKI1; MART2
Synonyms
HHAT; HHAT cDNA Clone; HHAT cdna clone
Sequence
atgctgccccgatgggaactggcactttacctacttgcctcactaggcttccacttctattccttctatgaagtttacaaagtctccagagaacacgaagaggagctggaccaggaatttgagctggagactgacactttatttggaggattaaagaaggatgcgaccgactttgagtggagcttctggatggaatgggggaagcagtggctggtgtggcttctccttggccacatggtagtgtctcaaatggccacactgctggcaagaaagcacagaccctggattctcatgctctatgggatgtgggcctgctggtgtgtgctggggacccctggtgtggctatggttttgctccataccaccatctctttctgcgtggcccagttccggtctcagctcctgacgtggctctgttctctcctcctcctctccacactgaggctgcagggtgtggaagaagttaagagaaggtggtacaagacagaaaacgagtactacctgctgcagttcacgctgaccgttcgctgcctctactacaccaacttcagcctggagctctgctggcagcagctgcctgctgcatcgacctcctactcctttccctggatgctggcctatgtcttttattatccagtcttacacaatgggcccatcctcagcttctcggagttcatcaaacagatgcagcagcaggagcatgactccctgaaggccagcctgtgtgtcctggccctggggctgggccgccttctttgctggtggtggctggccgagctgatggctcacctgatgtacatgcatgccatctacagcagcatccccctcctggagactgtctcttgttggaccttaggaggactggcgttagcccaggtgctctttttctacgtgaagtacttggtgctctttggcgtgcctgctctgctcatgcgcctggatggactcactccacccgccctcccccgctgcgtgagcaccatgttcagtttcaccgggatgtggaggtattttgatgttggactgcataatttcttaatcaggtatgtgtacattccagtgggcgggtcccagcatggcctgctggggacactgttttccacggcgatgacatttgcatttgtgagctactggcatggcggctacgactacctctggtgctgggcagcgctcaactggctgggagtcactgtggagaatggagtccggaggctggtggagactccctgcatccaggacagtctggcccgatacttctccccacaagctcgccgtcgattccacgctgcccttgcttcttgttccacctcgatgctgatcctgtccaacctggtatttcttgggggcaatgaggttgggaaaacctactggaataggatcttcatacaaggctggccttgggtgaccctctctgtcctgggattcctgtactgctactcccacgtgggcattgcctgggcccagacctacgccacggactaa
Sequence Length
1482
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,951 Da
NCBI Official Full Name
Homo sapiens hedgehog acyltransferase, mRNA
NCBI Official Synonym Full Names
hedgehog acyltransferase
NCBI Official Symbol
HHAT
NCBI Official Synonym Symbols
Skn; SKI1; MART2
NCBI Protein Information
protein-cysteine N-palmitoyltransferase HHAT
UniProt Protein Name
Protein-cysteine N-palmitoyltransferase HHAT
Protein Family
UniProt Gene Name
HHAT
UniProt Synonym Gene Names
MART2; SKI1; MART-2
UniProt Entry Name
HHAT_HUMAN
NCBI Description
'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
Uniprot Description
HHAT: Catalyzes N-terminal palmitoylation of SHH; which is required for SHH signaling. May bind GTP. Belongs to the membrane-bound acyltransferase family. HHAT subfamily. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: Transferase; EC 2.3.1.-; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 1q32
Cellular Component: endoplasmic reticulum membrane
Molecular Function: O-acyltransferase activity
Research Articles on HHAT
Similar Products
Product Notes
The HHAT hhat (Catalog #AAA1274152) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcccc gatgggaact ggcactttac ctacttgcct cactaggctt ccacttctat tccttctatg aagtttacaa agtctccaga gaacacgaag aggagctgga ccaggaattt gagctggaga ctgacacttt atttggagga ttaaagaagg atgcgaccga ctttgagtgg agcttctgga tggaatgggg gaagcagtgg ctggtgtggc ttctccttgg ccacatggta gtgtctcaaa tggccacact gctggcaaga aagcacagac cctggattct catgctctat gggatgtggg cctgctggtg tgtgctgggg acccctggtg tggctatggt tttgctccat accaccatct ctttctgcgt ggcccagttc cggtctcagc tcctgacgtg gctctgttct ctcctcctcc tctccacact gaggctgcag ggtgtggaag aagttaagag aaggtggtac aagacagaaa acgagtacta cctgctgcag ttcacgctga ccgttcgctg cctctactac accaacttca gcctggagct ctgctggcag cagctgcctg ctgcatcgac ctcctactcc tttccctgga tgctggccta tgtcttttat tatccagtct tacacaatgg gcccatcctc agcttctcgg agttcatcaa acagatgcag cagcaggagc atgactccct gaaggccagc ctgtgtgtcc tggccctggg gctgggccgc cttctttgct ggtggtggct ggccgagctg atggctcacc tgatgtacat gcatgccatc tacagcagca tccccctcct ggagactgtc tcttgttgga ccttaggagg actggcgtta gcccaggtgc tctttttcta cgtgaagtac ttggtgctct ttggcgtgcc tgctctgctc atgcgcctgg atggactcac tccacccgcc ctcccccgct gcgtgagcac catgttcagt ttcaccggga tgtggaggta ttttgatgtt ggactgcata atttcttaat caggtatgtg tacattccag tgggcgggtc ccagcatggc ctgctgggga cactgttttc cacggcgatg acatttgcat ttgtgagcta ctggcatggc ggctacgact acctctggtg ctgggcagcg ctcaactggc tgggagtcac tgtggagaat ggagtccgga ggctggtgga gactccctgc atccaggaca gtctggcccg atacttctcc ccacaagctc gccgtcgatt ccacgctgcc cttgcttctt gttccacctc gatgctgatc ctgtccaacc tggtatttct tgggggcaat gaggttggga aaacctactg gaataggatc ttcatacaag gctggccttg ggtgaccctc tctgtcctgg gattcctgta ctgctactcc cacgtgggca ttgcctgggc ccagacctac gccacggact aa. It is sometimes possible for the material contained within the vial of "HHAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
