LAMB3 cdna clone
LAMB3 cDNA Clone
Gene Names
LAMB3; AI1A; LAM5; LAMNB1; BM600-125KDA
Synonyms
LAMB3; LAMB3 cDNA Clone; LAMB3 cdna clone
Sequence
atgagaccattcttcctcttgtgttttgccctgcctggcctcctgcatgcccaacaagcctgctcccgtggggcctgctatccacctgttggggacctgcttgttgggaggacccggtttctccgagcttcatctacctgtggactgaccaagcctgagacctactgcacccagtatggcgagtggcagatgaaatgctgcaagtgtgactccaggcagcctcacaactactacagtcaccgagtagagaatgtggcttcatcctccggccccatgcgctggtggcagtcccagaatgatgtgaaccctgtctctctgcagctggacctggacaggagattccagcttcaagaagtcatgatggagttccaggggcccatgcctgccggcatgctgattgagcgctcctcagacttcggtaagacctggcgagtgtaccagtacctggctgccgactgcacctccaccttccctcgggtccgccagggtcggcctcagagctggcaggatgttcggtgccagtccctgcctcagaggcctaatgcacgcctaaatggggggaaggtccaacttaaccttatggatttagtgtctgggattccagcaactcaaagtcaaaaaattcaagaggtgggggagatcacaaacttgagagtcaatttcaccaggctggcccctgtgccccaaaggggctaccaccctcccagcgcctactatgctgtgtcccagctccgtctgcaggggagctgcttctgtcacggccatgctgatcgctgcgcacccaagcctggggcctctgcaggcccctccaccgctgtgcaggtccacgatgtctgtgtctgccagcacaacactgccggcccaaattgtgagcgctgtgcacccttctacaacaaccggccctggagaccggcggagggccaggacgcccatgaatgccaaaggtgcgactgcaatgggcactcagagacatgtcactttgaccccgctgtgtttgccgccagccagggggcatatggaggtgtgtgtgacaattgccgggaccacaccgaaggcaagaactgtgagcggtgtcagctgcactatttccggaaccggcgcccgggagcttccattcaggagacctgcatctcctgcgagtgtgatccggatggggcagtgccaggggctccctgtgacccagtgaccgggcagtgtgtgtgcaaggagcatgtgcagggagagcgctgtgacctatgcaagccgggcttcactggactcacctacgccaacccgcagggctgccaccgctgtgactgcaacatcctggggtcccggagggacatgccgtgtgacgaggagagtgggcgctgcctttgtctgcccaacgtggtgggtcccaaatgtgaccagtgtgctccctaccactggaagctggccagtggccagggctgtgaaccgtgtgcctgcgacccgcacaactccctcagcccacagtgcaaccagttcacagggcagtgcccctgtcgggaaggctttggtggcctgatgtgcagcgctgcagccatccgccagtgtccagaccggacctatggagacgtggccacaggatgccgagcctgtgactgtgatttccggggaacagagggcccgggctgcgacaaggcatcaggccgctgcctctgccgccctggcttgaccgggccccgctgtgaccagtgccagcgaggctactgcaatcgctacccggtgtgcgtggcctgccacccttgcttccagacctatgatgcggacctccgggagcaggccctgcgctttggtagactccgcaatgccaccgccagcctgtggtcagggcctgggctggaggaccgtggcctggcctcccggatcctagatgcaaagagtaagattgagcagatccgagcagttctcagcagccccgcagtcacagagcaggaggtggctcaggtggccagtgccatcctctccctcaggcgaactctccagggcctgcagctggatctgcccctggaggaggagacgttgtcccttccgagagacctggagagtcttgacagaagcttcaatggtctccttactatgtatcagaggaagagggagcagtttgaaaaaataagcagtgctgatccttcaggagccttccggatgctgagcacagcctacgagcagtcagcccaggctgctcagcaggtctccgacagctcgcgccttttggaccagctcagggacagccggagagaggcagagaggctggtgcggcaggcgggaggaggaggaggcaccggcagccccaagcttgtggccctgaggctggagatgtcttcgttgcctgacctgacacccaccttcaacaagctctgtggcaactccaggcagatggcttgcaccccaatatcatgccctggtgagctatgtccccaagacaatggcacagcctgtggctcccgctgcaggggtgtccttcccagggccggtggggccttcttgatggcggggcaggtggctgagcagctgcggggcttcaatgcccagctccagcggaccaggcagatgattagggcagccgaggaatctgcctcacagattcaatccagtgcccagcgcttggagacccaggtgagcgccagccgctcccagatggaggaagatgtcagacgcacacggctcctaatccagcaggtccgggacttcctaacagaccccgacactgatgcagccactatccaggaggtcagcgaggccgtgctggccctgtggctgcccacagactcagctactgttctgcagaagatgaatgagatccaggccattgcagccaggctccccaacgtggacttggtgctgtcccagaccaagcaggacattgcgcgtgcccgccggttgcaggctgaggctgaggaagccaggagccgagcccatgcagtggagggccaggtggaagatgtggttgggaacctgcggcaggggacagtggcactgcaggaagctcaggacaccatgcaaggcaccagccgctcccttcggcttatccaggacagggttgctgaggttcagcaggtactgcggccagcagaaaagctggtgacaagcatgaccaagcagctgggtgacttctggacacggatggaggagctccgccaccaagcccggcagcagggggcagaggcagtccaggcccagcagcttgcggaaggtgccagcgagcaggcattgagtgcccaagagggatttgagagaataaaacaaaagtatgctgagttgaaggaccggttgggtcagagttccatgctgggtgagcagggtgcccggatccagagtgtgaagacagaggcagaggagctgtttggggagaccatggagatgatggacaggatgaaagacatggagttggagctgctgcggggcagccaggccatcatgctgcgctcggcggacctgacaggactggagaagcgtgtggagcagatccgtgaccacatcaatgggcgcgtgctctactatgccacctgcaagtga
Sequence Length
3519
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
129,572 Da
NCBI Official Full Name
Homo sapiens laminin, beta 3, mRNA
NCBI Official Synonym Full Names
laminin subunit beta 3
NCBI Official Symbol
LAMB3
NCBI Official Synonym Symbols
AI1A; LAM5; LAMNB1; BM600-125KDA
NCBI Protein Information
laminin subunit beta-3
UniProt Protein Name
Laminin subunit beta-3
Protein Family
UniProt Gene Name
LAMB3
UniProt Synonym Gene Names
LAMNB1
UniProt Entry Name
LAMB3_HUMAN
NCBI Description
The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
LAMB3: Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Defects in LAMB3 are a cause of epidermolysis bullosa junctional Herlitz type (H-JEB); also known as junctional epidermolysis bullosa Herlitz-Pearson type. JEB defines a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement membrane. H-JEB is a severe, infantile and lethal form. Death occurs usually within the first six months of life. Occasionally, children survive to teens. H-JEB is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic. Defects in LAMB3 are a cause of generalized atrophic benign epidermolysis bullosa (GABEB). GABEB is a non- lethal, adult form of junctional epidermolysis bullosa characterized by life-long blistering of the skin, associated with hair and tooth abnormalities.
Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 1q32
Cellular Component: extracellular region
Molecular Function: protein binding
Biological Process: epidermis development; extracellular matrix disassembly; extracellular matrix organization and biogenesis; hemidesmosome assembly
Disease: Amelogenesis Imperfecta, Type Ia; Epidermolysis Bullosa, Junctional, Herlitz Type; Epidermolysis Bullosa, Junctional, Non-herlitz Type
Research Articles on LAMB3
Similar Products
Product Notes
The LAMB3 lamb3 (Catalog #AAA1274138) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaccat tcttcctctt gtgttttgcc ctgcctggcc tcctgcatgc ccaacaagcc tgctcccgtg gggcctgcta tccacctgtt ggggacctgc ttgttgggag gacccggttt ctccgagctt catctacctg tggactgacc aagcctgaga cctactgcac ccagtatggc gagtggcaga tgaaatgctg caagtgtgac tccaggcagc ctcacaacta ctacagtcac cgagtagaga atgtggcttc atcctccggc cccatgcgct ggtggcagtc ccagaatgat gtgaaccctg tctctctgca gctggacctg gacaggagat tccagcttca agaagtcatg atggagttcc aggggcccat gcctgccggc atgctgattg agcgctcctc agacttcggt aagacctggc gagtgtacca gtacctggct gccgactgca cctccacctt ccctcgggtc cgccagggtc ggcctcagag ctggcaggat gttcggtgcc agtccctgcc tcagaggcct aatgcacgcc taaatggggg gaaggtccaa cttaacctta tggatttagt gtctgggatt ccagcaactc aaagtcaaaa aattcaagag gtgggggaga tcacaaactt gagagtcaat ttcaccaggc tggcccctgt gccccaaagg ggctaccacc ctcccagcgc ctactatgct gtgtcccagc tccgtctgca ggggagctgc ttctgtcacg gccatgctga tcgctgcgca cccaagcctg gggcctctgc aggcccctcc accgctgtgc aggtccacga tgtctgtgtc tgccagcaca acactgccgg cccaaattgt gagcgctgtg cacccttcta caacaaccgg ccctggagac cggcggaggg ccaggacgcc catgaatgcc aaaggtgcga ctgcaatggg cactcagaga catgtcactt tgaccccgct gtgtttgccg ccagccaggg ggcatatgga ggtgtgtgtg acaattgccg ggaccacacc gaaggcaaga actgtgagcg gtgtcagctg cactatttcc ggaaccggcg cccgggagct tccattcagg agacctgcat ctcctgcgag tgtgatccgg atggggcagt gccaggggct ccctgtgacc cagtgaccgg gcagtgtgtg tgcaaggagc atgtgcaggg agagcgctgt gacctatgca agccgggctt cactggactc acctacgcca acccgcaggg ctgccaccgc tgtgactgca acatcctggg gtcccggagg gacatgccgt gtgacgagga gagtgggcgc tgcctttgtc tgcccaacgt ggtgggtccc aaatgtgacc agtgtgctcc ctaccactgg aagctggcca gtggccaggg ctgtgaaccg tgtgcctgcg acccgcacaa ctccctcagc ccacagtgca accagttcac agggcagtgc ccctgtcggg aaggctttgg tggcctgatg tgcagcgctg cagccatccg ccagtgtcca gaccggacct atggagacgt ggccacagga tgccgagcct gtgactgtga tttccgggga acagagggcc cgggctgcga caaggcatca ggccgctgcc tctgccgccc tggcttgacc gggccccgct gtgaccagtg ccagcgaggc tactgcaatc gctacccggt gtgcgtggcc tgccaccctt gcttccagac ctatgatgcg gacctccggg agcaggccct gcgctttggt agactccgca atgccaccgc cagcctgtgg tcagggcctg ggctggagga ccgtggcctg gcctcccgga tcctagatgc aaagagtaag attgagcaga tccgagcagt tctcagcagc cccgcagtca cagagcagga ggtggctcag gtggccagtg ccatcctctc cctcaggcga actctccagg gcctgcagct ggatctgccc ctggaggagg agacgttgtc ccttccgaga gacctggaga gtcttgacag aagcttcaat ggtctcctta ctatgtatca gaggaagagg gagcagtttg aaaaaataag cagtgctgat ccttcaggag ccttccggat gctgagcaca gcctacgagc agtcagccca ggctgctcag caggtctccg acagctcgcg ccttttggac cagctcaggg acagccggag agaggcagag aggctggtgc ggcaggcggg aggaggagga ggcaccggca gccccaagct tgtggccctg aggctggaga tgtcttcgtt gcctgacctg acacccacct tcaacaagct ctgtggcaac tccaggcaga tggcttgcac cccaatatca tgccctggtg agctatgtcc ccaagacaat ggcacagcct gtggctcccg ctgcaggggt gtccttccca gggccggtgg ggccttcttg atggcggggc aggtggctga gcagctgcgg ggcttcaatg cccagctcca gcggaccagg cagatgatta gggcagccga ggaatctgcc tcacagattc aatccagtgc ccagcgcttg gagacccagg tgagcgccag ccgctcccag atggaggaag atgtcagacg cacacggctc ctaatccagc aggtccggga cttcctaaca gaccccgaca ctgatgcagc cactatccag gaggtcagcg aggccgtgct ggccctgtgg ctgcccacag actcagctac tgttctgcag aagatgaatg agatccaggc cattgcagcc aggctcccca acgtggactt ggtgctgtcc cagaccaagc aggacattgc gcgtgcccgc cggttgcagg ctgaggctga ggaagccagg agccgagccc atgcagtgga gggccaggtg gaagatgtgg ttgggaacct gcggcagggg acagtggcac tgcaggaagc tcaggacacc atgcaaggca ccagccgctc ccttcggctt atccaggaca gggttgctga ggttcagcag gtactgcggc cagcagaaaa gctggtgaca agcatgacca agcagctggg tgacttctgg acacggatgg aggagctccg ccaccaagcc cggcagcagg gggcagaggc agtccaggcc cagcagcttg cggaaggtgc cagcgagcag gcattgagtg cccaagaggg atttgagaga ataaaacaaa agtatgctga gttgaaggac cggttgggtc agagttccat gctgggtgag cagggtgccc ggatccagag tgtgaagaca gaggcagagg agctgtttgg ggagaccatg gagatgatgg acaggatgaa agacatggag ttggagctgc tgcggggcag ccaggccatc atgctgcgct cggcggacct gacaggactg gagaagcgtg tggagcagat ccgtgaccac atcaatgggc gcgtgctcta ctatgccacc tgcaagtga. It is sometimes possible for the material contained within the vial of "LAMB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
