Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CTHRC1 cdna clone

CTHRC1 cDNA Clone

Synonyms
CTHRC1; CTHRC1 cDNA Clone; CTHRC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgaccccagggccccgccgcctccccgcagcggctccgcggcctcctgctgctcctgctgctgcagctgcccgcgccgtcgagcgcctctgagatccccaaggggaagcaaaaggcgcagctccggcagagggaggtggtggacctgtataatggaatgtgcttacaagggccagcaggagtgcctggtcgagacgggagccctggggccaatggcattccgggtacacctgggatcccaggtcgggatggattcaaaggagaaaagggggaatgtctgagggaaagctttgaggagtcctggacacccaactacaagcagtgttcatggagttcattgaattatggcatagatcttgggaaaattgcggagtgtacatttacaaagatgcgttcaaatagtgctctaagagttttgttcagtggctcacttcggctaaaatgcagaaatgcatgctgtcagcgttggtatttcacattcaatggagctgaatgttcaggacctcttcccattgaagctataatttatttggaccaaggaagccctgaaatgaattcaacaattaatattcatcgcacttcttctgtggaaggactttgtgaaggaattggtgctggattagtggatgttgctatctgggttggcacttgttcagattacccaaaaggagatgcttctactggatggaattcagtttctcgcatcattattgaagaactaccaaaataa
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,770 Da
NCBI Official Full Name
Homo sapiens collagen triple helix repeat containing 1, mRNA
NCBI Official Synonym Full Names
collagen triple helix repeat containing 1
NCBI Official Symbol
CTHRC1
NCBI Protein Information
collagen triple helix repeat-containing protein 1
UniProt Protein Name
Collagen triple helix repeat-containing protein 1
UniProt Gene Name
CTHRC1
UniProt Entry Name
CTHR1_HUMAN

NCBI Description

This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]

Uniprot Description

CTHRC1: May act as a negative regulator of collagen matrix deposition. Defects in CTHRC1 may be a cause of Barrett esophagus (BE). A condition characterized by a metaplastic change in which normal esophageal squamous epithelium is replaced by a columnar and intestinal-type epithelium. Patients with Barrett esophagus have an increased risk of esophageal adenocarcinoma. The main cause of Barrett esophagus is gastroesophageal reflux. The retrograde movement of acid and bile salts from the stomach into the esophagus causes prolonged injury to the esophageal epithelium and induces chronic esophagitis, which in turn is believed to trigger the pathologic changes. Genetic variants in CTHRC1 have been found in individuals with Barrett esophagus and are thought to contribute to disease susceptibility. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 8q22.3

Cellular Component: extracellular space

Disease: Barrett Esophagus

Research Articles on CTHRC1

Similar Products

Product Notes

The CTHRC1 cthrc1 (Catalog #AAA1274057) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgacccc agggccccgc cgcctccccg cagcggctcc gcggcctcct gctgctcctg ctgctgcagc tgcccgcgcc gtcgagcgcc tctgagatcc ccaaggggaa gcaaaaggcg cagctccggc agagggaggt ggtggacctg tataatggaa tgtgcttaca agggccagca ggagtgcctg gtcgagacgg gagccctggg gccaatggca ttccgggtac acctgggatc ccaggtcggg atggattcaa aggagaaaag ggggaatgtc tgagggaaag ctttgaggag tcctggacac ccaactacaa gcagtgttca tggagttcat tgaattatgg catagatctt gggaaaattg cggagtgtac atttacaaag atgcgttcaa atagtgctct aagagttttg ttcagtggct cacttcggct aaaatgcaga aatgcatgct gtcagcgttg gtatttcaca ttcaatggag ctgaatgttc aggacctctt cccattgaag ctataattta tttggaccaa ggaagccctg aaatgaattc aacaattaat attcatcgca cttcttctgt ggaaggactt tgtgaaggaa ttggtgctgg attagtggat gttgctatct gggttggcac ttgttcagat tacccaaaag gagatgcttc tactggatgg aattcagttt ctcgcatcat tattgaagaa ctaccaaaat aa. It is sometimes possible for the material contained within the vial of "CTHRC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.