Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RALGPS1 cdna clone

RALGPS1 cDNA Clone

Gene Names
RALGPS1; RALGEF2; RALGPS1A
Synonyms
RALGPS1; RALGPS1 cDNA Clone; RALGPS1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtacaagaggaatggtctgatggctagcgtgttggtcacctctgccactccacagggcagcagcagctcggactctctggagggccagagctgcgactatgccagcaagagctatgatgccgttgtcttcgatgtcttgaaagtgaccccagaggagtttgctagccagattacattaatggatatacctgtgtttaaagctatccagccggaggaactagccagctgtggatggagtaagaaggagaaacacactcttgcccctaacgttgtggcctttacccggaggtttaaccaggtcagtttttgggttgtacgagaaattctaacagcacagactttaaaaataagggcagaaatcctcagccattttgtgaaaatagccaagaaacttctagaactcaacaaccttcattctctcatgtctgtggtatcagcattacaaagtgctcccatcttcaggctgacaaaaacctgggctcttttaaatcgaaaagacaagactacctttgagaaattggactacctgatgtcgaaagaagataattacaagcggacacgggaatatatccgaagcctgaagatggttccaagtattccctatctaggaatctatcttctggatttaatctacattgattctgcatatcctgcctcaggcagtatcatggaaaatgaacaaagatccaatcagatgaacaatattcttcgaataattgctgatttacaagtttcctgcagctatgatcacctcaccaccctgccccatgtgcagaagtacctgaagtccgtacgctacattgaagagctccagaagtttgtggaagacgacaactacaaactgtcgctcagaatcgaaccaggaagcagctctccaagactagtctcttccaaggaagatcttgcagccatgtga
Sequence Length
918
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,865 Da
NCBI Official Full Name
Homo sapiens Ral GEF with PH domain and SH3 binding motif 1, mRNA
NCBI Official Synonym Full Names
Ral GEF with PH domain and SH3 binding motif 1
NCBI Official Symbol
RALGPS1
NCBI Official Synonym Symbols
RALGEF2; RALGPS1A
NCBI Protein Information
ras-specific guanine nucleotide-releasing factor RalGPS1
UniProt Protein Name
Ras-specific guanine nucleotide-releasing factor RalGPS1
UniProt Gene Name
RALGPS1
UniProt Synonym Gene Names
KIAA0351; RALGEF2; RalGEF 2
UniProt Entry Name
RGPS1_HUMAN

Uniprot Description

RALGPS1: Guanine nucleotide exchange factor (GEF) for the small GTPase RALA. May be involved in cytoskeletal organization. Guanine nucleotide exchange factor for. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, misc.

Chromosomal Location of Human Ortholog: 9q33.3

Molecular Function: Ral guanyl-nucleotide exchange factor activity

Biological Process: regulation of Ral protein signal transduction

Research Articles on RALGPS1

Similar Products

Product Notes

The RALGPS1 ralgps1 (Catalog #AAA1274036) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacaaga ggaatggtct gatggctagc gtgttggtca cctctgccac tccacagggc agcagcagct cggactctct ggagggccag agctgcgact atgccagcaa gagctatgat gccgttgtct tcgatgtctt gaaagtgacc ccagaggagt ttgctagcca gattacatta atggatatac ctgtgtttaa agctatccag ccggaggaac tagccagctg tggatggagt aagaaggaga aacacactct tgcccctaac gttgtggcct ttacccggag gtttaaccag gtcagttttt gggttgtacg agaaattcta acagcacaga ctttaaaaat aagggcagaa atcctcagcc attttgtgaa aatagccaag aaacttctag aactcaacaa ccttcattct ctcatgtctg tggtatcagc attacaaagt gctcccatct tcaggctgac aaaaacctgg gctcttttaa atcgaaaaga caagactacc tttgagaaat tggactacct gatgtcgaaa gaagataatt acaagcggac acgggaatat atccgaagcc tgaagatggt tccaagtatt ccctatctag gaatctatct tctggattta atctacattg attctgcata tcctgcctca ggcagtatca tggaaaatga acaaagatcc aatcagatga acaatattct tcgaataatt gctgatttac aagtttcctg cagctatgat cacctcacca ccctgcccca tgtgcagaag tacctgaagt ccgtacgcta cattgaagag ctccagaagt ttgtggaaga cgacaactac aaactgtcgc tcagaatcga accaggaagc agctctccaa gactagtctc ttccaaggaa gatcttgcag ccatgtga. It is sometimes possible for the material contained within the vial of "RALGPS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.