Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TUBGCP3 cdna clone

TUBGCP3 cDNA Clone

Gene Names
TUBGCP3; 104p; GCP3; Spc98; SPBC98; Spc98p; Grip104
Synonyms
TUBGCP3; TUBGCP3 cDNA Clone; TUBGCP3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaccccggaccagaagtcgccgaacgttctgctgcagaacctgtgctgcaggatcctgggcaggagcgaagctgatgtagcccagcagttccagtatgctgtgcgggtgattggcagcaacttcgccccaactgttgaaagagatgaatttttagtagctgaaaaaatcaagaaagagcttattcgacaacgaagagaagcagatgctgcattattttcagaactccacagaaaacttcattcacagggagttttgaaaaataaatggtcaatactctacctcttgctgagcctcagtgaggacccacgcaggcagccaagcaaggtttctagctatgctacgttatttgctcaggccttaccaagagatgcccactcaaccccttactactatgccaggcctcagacccttcccctgagctaccaagatcggagtgcccagtcagcccagagctccggcagcgtgggcagcagtggcatcagcagcattggcctgtgtgccctcagtggccccgcgcctgcgccacaatctctcctcccaggacagtctaatcaagctccaggagtaggagattgccttcgacagcagttggggtcacgactcgcatggactttaactgcaaatcagccttcttcacaagccactacctcaaaaggtgtccccagtgctgtgtctcgcaacatgacaaggtccaggagagaaggggatacgggtggtactatggaaattacagaagcagctctggtaagggacattttgtacgtctttcagggcatagatggcaaaaacatcaaaatgaacaacactgaaaattgttacaaagtagaaggaaaggcaaatctaagtaggtctttgagagacacagcagtcaggctttctgagttgggatggttgcataataaaatcagaagatacacggaccagaggagcctggaccgctcattcggactcgtcgggcagagcttttgtgctgccttgcaccaggaactcagagaatactatcgattgctctctgttttacattctcagctacaactagaggatgaccagggtgtgaatttgggacttgagagtagtttaacacttcggcgcctcctggtttggacctatgatcccaaaatacgactgaagacccttgcggccctagtggaccactgccaaggaaggaaaggaggtgagctggcctcagctgtccacgcctacacaaaaacaggagacccgtacatgcggtctctggtgcagcacatcctcagcctcgtgtctcatcctgttttgagcttcctgtaccgctggatatatgatggggagcttgaggacacttaccacgaattttttgtagcatcagatccaacagttaaaacagatcgactgtggcacgacaagtatactttgaggaaatcgatgattccttcgtttatgacgatggatcagtctaggaaggtccttttgataggaaaatcaataaatttcttgcaccaagtttgtcatgatcagactcccactacaaagatgatagctgtgaccaagtctgcagagtcaccccaggacgctgcagacctattcacagacttggaaaatgcatttcaggggaagattgatgctgcttattttgagaccagcaaatacctgttggatgttctcaataaaaagtacagcttgctggaccacatgcaggcaatgaggcggtacctgcttcttggtcaaggagactttataaggcacttaatggacttgctaaaaccagaacttgtccgtccagctacgactttgtatcagcataacttgactggaattctagaaaccgctgtcagagccaccaacgcacagtttgacagtcctgagatcctgcgaaggctggacgtgcggctgctggaggtctctccaggtgacactggatgggatgtcttcagcctcgattatcatgttgacggaccaattgcaactgtgtttactcgagaatgtatgagccactacctaagagtatttaacttcctctggagggcgaagcggatggaatacatcctcactgacatacggaagggacacatgtgcaatgcaaagctcctgagaaacatgccagagttctccggggtgctgcaccagtgtcacattttggcctctgagatggtccatttcattcatcagatgcagtattacatcacatttgaggtgcttgaatgttcttgggatgagctttggaacaaagtccagcaggcccaggatttggatcacatcattgctgcacacgaggtgttcttagacaccatcatctcccgctgcctgctggacagtgactccagggcacttttaaatcaacttagagctgtgtttgatcaaattattgaacttcagaatgctcaagatgcaatatacagagctgctctggaagaattgcagagacgattacagtttgaagagaaaaagaaacagcgtgaaattgaggttgagatgtgcctatactgcgtttga
Sequence Length
2475
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,647 Da
NCBI Official Full Name
Homo sapiens tubulin, gamma complex associated protein 3, mRNA
NCBI Official Synonym Full Names
tubulin gamma complex associated protein 3
NCBI Official Symbol
TUBGCP3
NCBI Official Synonym Symbols
104p; GCP3; Spc98; SPBC98; Spc98p; Grip104
NCBI Protein Information
gamma-tubulin complex component 3
UniProt Protein Name
Gamma-tubulin complex component 3
UniProt Gene Name
TUBGCP3
UniProt Synonym Gene Names
GCP3; GCP-3; hGCP3; h104p; hGrip104; hSpc98
UniProt Entry Name
GCP3_HUMAN

Uniprot Description

GCP3: Gamma-tubulin complex is necessary for microtubule nucleation at the centrosome. Belongs to the TUBGCP family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 13q34

Cellular Component: centriole; centrosome; cytoplasm; cytosol; gamma-tubulin small complex; membrane; polar microtubule; spindle pole body

Molecular Function: gamma-tubulin binding; microtubule minus-end binding; protein binding; structural constituent of cytoskeleton

Biological Process: centrosome duplication; cytoplasmic microtubule organization and biogenesis; interphase microtubule nucleation by interphase microtubule organizing center; meiosis

Research Articles on TUBGCP3

Similar Products

Product Notes

The TUBGCP3 tubgcp3 (Catalog #AAA1273979) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccc cggaccagaa gtcgccgaac gttctgctgc agaacctgtg ctgcaggatc ctgggcagga gcgaagctga tgtagcccag cagttccagt atgctgtgcg ggtgattggc agcaacttcg ccccaactgt tgaaagagat gaatttttag tagctgaaaa aatcaagaaa gagcttattc gacaacgaag agaagcagat gctgcattat tttcagaact ccacagaaaa cttcattcac agggagtttt gaaaaataaa tggtcaatac tctacctctt gctgagcctc agtgaggacc cacgcaggca gccaagcaag gtttctagct atgctacgtt atttgctcag gccttaccaa gagatgccca ctcaacccct tactactatg ccaggcctca gacccttccc ctgagctacc aagatcggag tgcccagtca gcccagagct ccggcagcgt gggcagcagt ggcatcagca gcattggcct gtgtgccctc agtggccccg cgcctgcgcc acaatctctc ctcccaggac agtctaatca agctccagga gtaggagatt gccttcgaca gcagttgggg tcacgactcg catggacttt aactgcaaat cagccttctt cacaagccac tacctcaaaa ggtgtcccca gtgctgtgtc tcgcaacatg acaaggtcca ggagagaagg ggatacgggt ggtactatgg aaattacaga agcagctctg gtaagggaca ttttgtacgt ctttcagggc atagatggca aaaacatcaa aatgaacaac actgaaaatt gttacaaagt agaaggaaag gcaaatctaa gtaggtcttt gagagacaca gcagtcaggc tttctgagtt gggatggttg cataataaaa tcagaagata cacggaccag aggagcctgg accgctcatt cggactcgtc gggcagagct tttgtgctgc cttgcaccag gaactcagag aatactatcg attgctctct gttttacatt ctcagctaca actagaggat gaccagggtg tgaatttggg acttgagagt agtttaacac ttcggcgcct cctggtttgg acctatgatc ccaaaatacg actgaagacc cttgcggccc tagtggacca ctgccaagga aggaaaggag gtgagctggc ctcagctgtc cacgcctaca caaaaacagg agacccgtac atgcggtctc tggtgcagca catcctcagc ctcgtgtctc atcctgtttt gagcttcctg taccgctgga tatatgatgg ggagcttgag gacacttacc acgaattttt tgtagcatca gatccaacag ttaaaacaga tcgactgtgg cacgacaagt atactttgag gaaatcgatg attccttcgt ttatgacgat ggatcagtct aggaaggtcc ttttgatagg aaaatcaata aatttcttgc accaagtttg tcatgatcag actcccacta caaagatgat agctgtgacc aagtctgcag agtcacccca ggacgctgca gacctattca cagacttgga aaatgcattt caggggaaga ttgatgctgc ttattttgag accagcaaat acctgttgga tgttctcaat aaaaagtaca gcttgctgga ccacatgcag gcaatgaggc ggtacctgct tcttggtcaa ggagacttta taaggcactt aatggacttg ctaaaaccag aacttgtccg tccagctacg actttgtatc agcataactt gactggaatt ctagaaaccg ctgtcagagc caccaacgca cagtttgaca gtcctgagat cctgcgaagg ctggacgtgc ggctgctgga ggtctctcca ggtgacactg gatgggatgt cttcagcctc gattatcatg ttgacggacc aattgcaact gtgtttactc gagaatgtat gagccactac ctaagagtat ttaacttcct ctggagggcg aagcggatgg aatacatcct cactgacata cggaagggac acatgtgcaa tgcaaagctc ctgagaaaca tgccagagtt ctccggggtg ctgcaccagt gtcacatttt ggcctctgag atggtccatt tcattcatca gatgcagtat tacatcacat ttgaggtgct tgaatgttct tgggatgagc tttggaacaa agtccagcag gcccaggatt tggatcacat cattgctgca cacgaggtgt tcttagacac catcatctcc cgctgcctgc tggacagtga ctccagggca cttttaaatc aacttagagc tgtgtttgat caaattattg aacttcagaa tgctcaagat gcaatataca gagctgctct ggaagaattg cagagacgat tacagtttga agagaaaaag aaacagcgtg aaattgaggt tgagatgtgc ctatactgcg tttga. It is sometimes possible for the material contained within the vial of "TUBGCP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.