ACOT1 cdna clone
ACOT1 cDNA Clone
Gene Names
ACOT1; ACH2; CTE-1; LACH2
Synonyms
ACOT1; ACOT1 cDNA Clone; ACOT1 cdna clone
Sequence
atggcggcgacgctgatcctggagcccgcgggccgctgctgctgggacgaaccggtgcgaatcgccgtgcgcggcctagccccggagcagccggtcacgctgcgcgcgtccctgcgcgacgagaagggcgcgcttttccaggcccacgcgcgctaccgcgccgacacccttggcgagctggacctggagcgcgcgcccgcgctgggcggcagcttcgcggggcttgagcccatggggctgctctgggccttggagcccgagaaacccttggtgcggctggtgaagcgcgacgtgcgaacgcccttggccgtggagctggaggtgctggatggccacgaccccgaccccgggcggctgctgtgccgggtgcggcacgagcgctacttcctcccgcccggggtgcggcgcgagccggtgcgcgcgggccgggtgcgaggcacgctcttcctgccgccagaacctgggccctttcctggcattgtggacatgttcggaactggaggtggcctgctggagtatcgggctagtctgctggctgggaagggttttgctgtgatggctctggcttactataactatgaagacctccccaagaccatggagacgctccatctggagtactttgaagaagctgtgaactacttgctcagtcatcctgaggtaaaaggtccaggagttgggctgcttggaatttccaaagggggtgagctctgcctttccatggcctctttcctgaagggcatcacggctgctgtcgtcatcaacggctctgtggccaatgttgggggaaccttacgctacaagggcgagaccctgccccctgtgggcgtcaacagaaatcgcatcaaggtgaccaaagatggctatgcagacattgtggatgtcctgaacagccctttggaaggacctgaccagaagagcttcattcctgtggaaagggcagagagcaccttcctgttcctggtaggtcaggatgaccacaactggaagagtgagttctatgctaatgaggcctgtaaacgcttgcaggcccatgggaggagaaagccccagatcatctgttacccagagacagggcactatattgagcctccttacttccccctgtgtcgggcttccctgcatgccttggtgggcagtcctattatctggggaggggagcccagggctcatgccatggctcaggtggatgcttggaaacaactccagactttcttccacaaacacttgggtggccacgaggggacaatcccatcaaaagtgtaa
Sequence Length
1266
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,277 Da
NCBI Official Full Name
Homo sapiens acyl-CoA thioesterase 1, mRNA
NCBI Official Synonym Full Names
acyl-CoA thioesterase 1
NCBI Official Symbol
ACOT1
NCBI Official Synonym Symbols
ACH2; CTE-1; LACH2
NCBI Protein Information
acyl-coenzyme A thioesterase 1
UniProt Protein Name
Acyl-coenzyme A thioesterase 1
Protein Family
UniProt Gene Name
ACOT1
UniProt Synonym Gene Names
CTE1; Acyl-CoA thioesterase 1; Long chain acyl-CoA hydrolase
UniProt Entry Name
ACOT1_HUMAN
Uniprot Description
ACOT1: Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs to the free fatty acid and coenzyme A (CoASH), providing the potential to regulate intracellular levels of acyl-CoAs, free fatty acids and CoASH. Active towards fatty acyl-CoA with chain-lengths of C12-C16. Belongs to the C/M/P thioester hydrolase family.
Protein type: EC 3.1.2.2; Lipid Metabolism - unsaturated fatty acid biosynthesis; Hydrolase
Chromosomal Location of Human Ortholog: 14q24.3
Cellular Component: cytosol
Molecular Function: acyl-CoA hydrolase activity
Biological Process: acyl-CoA metabolic process; long-chain fatty acid metabolic process; very-long-chain fatty acid metabolic process
Similar Products
Product Notes
The ACOT1 acot1 (Catalog #AAA1273938) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga cgctgatcct ggagcccgcg ggccgctgct gctgggacga accggtgcga atcgccgtgc gcggcctagc cccggagcag ccggtcacgc tgcgcgcgtc cctgcgcgac gagaagggcg cgcttttcca ggcccacgcg cgctaccgcg ccgacaccct tggcgagctg gacctggagc gcgcgcccgc gctgggcggc agcttcgcgg ggcttgagcc catggggctg ctctgggcct tggagcccga gaaacccttg gtgcggctgg tgaagcgcga cgtgcgaacg cccttggccg tggagctgga ggtgctggat ggccacgacc ccgaccccgg gcggctgctg tgccgggtgc ggcacgagcg ctacttcctc ccgcccgggg tgcggcgcga gccggtgcgc gcgggccggg tgcgaggcac gctcttcctg ccgccagaac ctgggccctt tcctggcatt gtggacatgt tcggaactgg aggtggcctg ctggagtatc gggctagtct gctggctggg aagggttttg ctgtgatggc tctggcttac tataactatg aagacctccc caagaccatg gagacgctcc atctggagta ctttgaagaa gctgtgaact acttgctcag tcatcctgag gtaaaaggtc caggagttgg gctgcttgga atttccaaag ggggtgagct ctgcctttcc atggcctctt tcctgaaggg catcacggct gctgtcgtca tcaacggctc tgtggccaat gttgggggaa ccttacgcta caagggcgag accctgcccc ctgtgggcgt caacagaaat cgcatcaagg tgaccaaaga tggctatgca gacattgtgg atgtcctgaa cagccctttg gaaggacctg accagaagag cttcattcct gtggaaaggg cagagagcac cttcctgttc ctggtaggtc aggatgacca caactggaag agtgagttct atgctaatga ggcctgtaaa cgcttgcagg cccatgggag gagaaagccc cagatcatct gttacccaga gacagggcac tatattgagc ctccttactt ccccctgtgt cgggcttccc tgcatgcctt ggtgggcagt cctattatct ggggagggga gcccagggct catgccatgg ctcaggtgga tgcttggaaa caactccaga ctttcttcca caaacacttg ggtggccacg aggggacaat cccatcaaaa gtgtaa. It is sometimes possible for the material contained within the vial of "ACOT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
