Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNN3 cdna clone

KCNN3 cDNA Clone

Gene Names
KCNN3; SK3; hSK3; SKCA3; KCa2.3
Synonyms
KCNN3; KCNN3 cDNA Clone; KCNN3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcctgtacatcagcctggagatgctggtgtgcgccatccaccccattcctggcgagtacaagttcttctggacggcacgcctggccttctcctacacaccctcccgggcggaggccgatgtggacatcatcctgtctatccccatgttcctgcgcctgtacctgatcgcccgagtcatgctgctgcacagcaagctcttcaccgatgcctcgtcccgcagcatcggggccctcaacaagatcaacttcaacacccgctttgtcatgaagacgctcatgaccatctgccctggcactgtgctgctcgtgttcagcatctctctgtggatcattgctgcctggaccgtccgtgtctgtgaaaggtaccatgaccagcaggacgtaactagtaactttctgggtgccatgtggctcatctccatcacattcctttccattggttatggggacatggtgccccacacatactgtgggaaaggtgtctgtctcctcactggcatcatgggtgcaggctgcactgcccttgtggtggccgtggtggcccgaaagctggaactcaccaaagcggagaagcacgttcataacttcatgatggacactcagctcaccaagcggatcaagaatgctgcagccaatgtccttcgggaaacatggttaatctataaacacacaaagctgctaaagaagattgaccatgccaaagtgaggaaacaccagaggaagttcctccaagctatccaccagttgaggagcgtcaagatggaacagaggaagctgagtgaccaagccaacactctggtggacctttccaagatgcagaatgtcatgtatgacttaatcacagaactcaatgaccggagcgaagacctggagaagcagattggcagcctggagtcgaagctggagcatctcaccgccagcttcaactccctgccgctgctcatcgccgacaccctgcgccagcagcagcagcagctcctgtctgccatcatcgaggcccggggtgtcagcgtggcagtgggcaccacccacaccccaatctccgatagccccattggggtcagctccacctccttcccgaccccgtacacaagttcaagcagttgctaa
Sequence Length
1281
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,093 Da
NCBI Official Full Name
Homo sapiens potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3, mRNA
NCBI Official Synonym Full Names
potassium calcium-activated channel subfamily N member 3
NCBI Official Symbol
KCNN3
NCBI Official Synonym Symbols
SK3; hSK3; SKCA3; KCa2.3
NCBI Protein Information
small conductance calcium-activated potassium channel protein 3
UniProt Protein Name
Small conductance calcium-activated potassium channel protein 3
UniProt Gene Name
KCNN3
UniProt Synonym Gene Names
K3; SK3; SKCa 3; SKCa3
UniProt Entry Name
KCNN3_HUMAN

NCBI Description

Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

KCNN3: Forms a voltage-independent potassium channel activated by intracellular calcium. Activation is followed by membrane hyperpolarization. Thought to regulate neuronal excitability by contributing to the slow component of synaptic afterhyperpolarization. The channel is blocked by apamin. Belongs to the potassium channel KCNN family. KCa2.3/KCNN3 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: cell soma; plasma membrane

Molecular Function: calmodulin binding; small conductance calcium-activated potassium channel activity

Research Articles on KCNN3

Similar Products

Product Notes

The KCNN3 kcnn3 (Catalog #AAA1273904) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagac ctataaagga ctccatgttt tcgttggccc tgaaatgcct tatcagtctg tccaccatca tccttttggg cttgatcatc gcctaccaca cacgtgaagt ccagctcttc gtgatcgaca atggcgcgga tgactggcgg atagccatga cctacgagcg catcctgtac atcagcctgg agatgctggt gtgcgccatc caccccattc ctggcgagta caagttcttc tggacggcac gcctggcctt ctcctacaca ccctcccggg cggaggccga tgtggacatc atcctgtcta tccccatgtt cctgcgcctg tacctgatcg cccgagtcat gctgctgcac agcaagctct tcaccgatgc ctcgtcccgc agcatcgggg ccctcaacaa gatcaacttc aacacccgct ttgtcatgaa gacgctcatg accatctgcc ctggcactgt gctgctcgtg ttcagcatct ctctgtggat cattgctgcc tggaccgtcc gtgtctgtga aaggtaccat gaccagcagg acgtaactag taactttctg ggtgccatgt ggctcatctc catcacattc ctttccattg gttatgggga catggtgccc cacacatact gtgggaaagg tgtctgtctc ctcactggca tcatgggtgc aggctgcact gcccttgtgg tggccgtggt ggcccgaaag ctggaactca ccaaagcgga gaagcacgtt cataacttca tgatggacac tcagctcacc aagcggatca agaatgctgc agccaatgtc cttcgggaaa catggttaat ctataaacac acaaagctgc taaagaagat tgaccatgcc aaagtgagga aacaccagag gaagttcctc caagctatcc accagttgag gagcgtcaag atggaacaga ggaagctgag tgaccaagcc aacactctgg tggacctttc caagatgcag aatgtcatgt atgacttaat cacagaactc aatgaccgga gcgaagacct ggagaagcag attggcagcc tggagtcgaa gctggagcat ctcaccgcca gcttcaactc cctgccgctg ctcatcgccg acaccctgcg ccagcagcag cagcagctcc tgtctgccat catcgaggcc cggggtgtca gcgtggcagt gggcaccacc cacaccccaa tctccgatag ccccattggg gtcagctcca cctccttccc gaccccgtac acaagttcaa gcagttgcta a. It is sometimes possible for the material contained within the vial of "KCNN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.