IFLTD1 cdna clone
IFLTD1 cDNA Clone
Gene Names
LMNTD1; IFLTD1; PAS1C1
Synonyms
IFLTD1; IFLTD1 cDNA Clone; IFLTD1 cdna clone
Sequence
atgattggggatggagaagattatttcctttctttgtttggtgattcaaagaaacttacagcacactcaaactacactcagaaaactttaaaatacttttctatgattcttgaagaagttggccaatttacctccagttctcttggagatgttgaaatagctgaagtgaatgtcaagggtttgttcgtgaagctcattaactcttcccttgacaaagaaatggcaattggagatcatattctccagcaaaatgtgaatggacaaaccatttctttgtaccgattccttccaaacatcgtaatgcaggcaaattccacagtaacagtgtgggcagcagcatctgaagcaaagcatcaacctccatcagattttctttggaaggaacaagacaagtttagagcaagtcctgattgtataacaatcctgtgcaaaccgaacggtcaagccattgcgtggtacacccctatccactggaagcaagcgtgggaaaaattagatgctgacgttgaatttaacagatgttcagtagtatctccaacattccgaaagcgtgtgtttcagtggacagcatctacagctacaataactaaagaaaaacaagatcaacctaagaaagatatctcaaattatcaggtggaacaagctcaagttcttcttaagagagagaaggaaatcccaccaaccgttttccctaatcgcagcccttggtgccagaatccctatgtctctgcacatccttactgtcctctgattgaaccacacaatacatccaccgctggaggcagattggatagacagcccaggtctcggtcaaccagacctaatcgagcctcagggtctaagaaaaagaagacatctgagtcacaaaagcaataa
Sequence Length
876
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,891 Da
NCBI Official Full Name
Homo sapiens intermediate filament tail domain containing 1, mRNA
NCBI Official Synonym Full Names
lamin tail domain containing 1
NCBI Official Symbol
LMNTD1
NCBI Official Synonym Symbols
IFLTD1; PAS1C1
NCBI Protein Information
lamin tail domain-containing protein 1
UniProt Protein Name
Lamin tail domain-containing protein 1
UniProt Gene Name
LMNTD1
UniProt Synonym Gene Names
IFLTD1
UniProt Entry Name
LMTD1_HUMAN
Uniprot Description
IFLTD1: Belongs to the intermediate filament family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Nuclear envelope
Chromosomal Location of Human Ortholog: 12p12.1
Similar Products
Product Notes
The IFLTD1 lmntd1 (Catalog #AAA1273878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgggg atggagaaga ttatttcctt tctttgtttg gtgattcaaa gaaacttaca gcacactcaa actacactca gaaaacttta aaatactttt ctatgattct tgaagaagtt ggccaattta cctccagttc tcttggagat gttgaaatag ctgaagtgaa tgtcaagggt ttgttcgtga agctcattaa ctcttccctt gacaaagaaa tggcaattgg agatcatatt ctccagcaaa atgtgaatgg acaaaccatt tctttgtacc gattccttcc aaacatcgta atgcaggcaa attccacagt aacagtgtgg gcagcagcat ctgaagcaaa gcatcaacct ccatcagatt ttctttggaa ggaacaagac aagtttagag caagtcctga ttgtataaca atcctgtgca aaccgaacgg tcaagccatt gcgtggtaca cccctatcca ctggaagcaa gcgtgggaaa aattagatgc tgacgttgaa tttaacagat gttcagtagt atctccaaca ttccgaaagc gtgtgtttca gtggacagca tctacagcta caataactaa agaaaaacaa gatcaaccta agaaagatat ctcaaattat caggtggaac aagctcaagt tcttcttaag agagagaagg aaatcccacc aaccgttttc cctaatcgca gcccttggtg ccagaatccc tatgtctctg cacatcctta ctgtcctctg attgaaccac acaatacatc caccgctgga ggcagattgg atagacagcc caggtctcgg tcaaccagac ctaatcgagc ctcagggtct aagaaaaaga agacatctga gtcacaaaag caataa. It is sometimes possible for the material contained within the vial of "IFLTD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
