Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM3A cdna clone

FAM3A cDNA Clone

Gene Names
FAM3A; DLD; 2.19; XAP-7; DXS560S
Synonyms
FAM3A; FAM3A cDNA Clone; FAM3A cdna clone
Ordering
For Research Use Only!
Sequence
atgaggttggcaggccctctccgcattgtggtcctagtcgtcagtgtgggtgtcacatggatcgtggtcagcatcctcctgggtgggcctggcagtggctttcctcgcatccagcaactcttcaccagctggagtgcagtggtgcaatctcggttcactgcaacctctacctcctgggttcaagcgattctagtgccccagcctcccgagtag
Sequence Length
213
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,164 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 3, member A, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 3 member A
NCBI Official Symbol
FAM3A
NCBI Official Synonym Symbols
DLD; 2.19; XAP-7; DXS560S
NCBI Protein Information
protein FAM3A
UniProt Protein Name
Protein FAM3A
Protein Family
UniProt Gene Name
FAM3A
UniProt Synonym Gene Names
2-19; 2.19
UniProt Entry Name
FAM3A_HUMAN

NCBI Description

This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

FAM3A: May act as a defensin against invading fungal microorganisms. Belongs to the FAM3 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: Xq28

Research Articles on FAM3A

Similar Products

Product Notes

The FAM3A fam3a (Catalog #AAA1273804) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggttgg caggccctct ccgcattgtg gtcctagtcg tcagtgtggg tgtcacatgg atcgtggtca gcatcctcct gggtgggcct ggcagtggct ttcctcgcat ccagcaactc ttcaccagct ggagtgcagt ggtgcaatct cggttcactg caacctctac ctcctgggtt caagcgattc tagtgcccca gcctcccgag tag. It is sometimes possible for the material contained within the vial of "FAM3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.