Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RHEBL1 cdna clone

RHEBL1 cDNA Clone

Gene Names
RHEBL1; RHEBL1c
Synonyms
RHEBL1; RHEBL1 cDNA Clone; RHEBL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgctagtccgctacaggaaggtggtcatcctcggataccgctgtgtagggaagacatctttggcacatcaatttgtggaaggcgagttctcggaaggctacgatcctacagtggagaatacttacagcaagatagtgactcttggcaaagatgagtttcacctacatttggtggacacagcagggcaggatgagtacagcattctgccctattcattcatcattggggtccatggttatgtgcttgtgtattctgtcacctctctgcatagcttccaagtcattgagagtctgtaccaaaagctacatgaaggccatgggaaaacccgggtgccagtggttctagtggggaacaaggcagatctctctccagagagagaggtacaggcagttgaaggaaagaagctggcagagtcctggggtgcgacatttatggagtcatctgctcgagagaatcagctgactcaaggcatcttcaccaaagtcatccaggagattgcccgtgtggagaattcctatgggcaagagcgtcgctgccatctcatgtga
Sequence Length
552
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,176 Da
NCBI Official Full Name
Homo sapiens Ras homolog enriched in brain like 1, mRNA
NCBI Official Synonym Full Names
Ras homolog enriched in brain like 1
NCBI Official Symbol
RHEBL1
NCBI Official Synonym Symbols
RHEBL1c
NCBI Protein Information
GTPase RhebL1
UniProt Protein Name
GTPase RhebL1
Protein Family
UniProt Gene Name
RHEBL1
UniProt Synonym Gene Names
RhebL1c; Rheb-like protein 1
UniProt Entry Name
REBL1_HUMAN

Uniprot Description

RHEBL1: Binds GTP and exhibits intrinsic GTPase activity. May activate NF-kappa-B-mediated gene transcription. Promotes signal transduction through MTOR, activates RPS6KB1, and is a downstream target of the small GTPase-activating proteins TSC1 and TSC2. Belongs to the small GTPase superfamily. Rheb family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, monomeric; G protein; G protein, monomeric, Rheb

Chromosomal Location of Human Ortholog: 12q13.12

Cellular Component: cytoplasm

Molecular Function: GTP binding; protein binding

Biological Process: activation of NF-kappaB transcription factor; TOR signaling pathway

Research Articles on RHEBL1

Similar Products

Product Notes

The RHEBL1 rhebl1 (Catalog #AAA1273763) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctag tccgctacag gaaggtggtc atcctcggat accgctgtgt agggaagaca tctttggcac atcaatttgt ggaaggcgag ttctcggaag gctacgatcc tacagtggag aatacttaca gcaagatagt gactcttggc aaagatgagt ttcacctaca tttggtggac acagcagggc aggatgagta cagcattctg ccctattcat tcatcattgg ggtccatggt tatgtgcttg tgtattctgt cacctctctg catagcttcc aagtcattga gagtctgtac caaaagctac atgaaggcca tgggaaaacc cgggtgccag tggttctagt ggggaacaag gcagatctct ctccagagag agaggtacag gcagttgaag gaaagaagct ggcagagtcc tggggtgcga catttatgga gtcatctgct cgagagaatc agctgactca aggcatcttc accaaagtca tccaggagat tgcccgtgtg gagaattcct atgggcaaga gcgtcgctgc catctcatgt ga. It is sometimes possible for the material contained within the vial of "RHEBL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.