Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF558 cdna clone

ZNF558 cDNA Clone

Synonyms
ZNF558; ZNF558 cDNA Clone; ZNF558 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctgtcatcctgccctcgactgctgctccgtcttccctgttcccagcctctcagcaaaaaggacacacacagggcggagagctggttaatgagctcctgacaagctggctacggggcttggtaaccttcgaggatgtggccgtggagttcacccaggaggagtgggcgttgctggaccctgcccaaaggacactgtacagggatgtgatgctggagaactgcaggaacctggcctcactagggtgtcgtgttaataaacccagtctgatatcccagttggaacaagacaagaaggtggtgacagaggaaagaggaattctaccaagcacctgtccagatttggagactctacttaaagccaaatggttaactcctaagaagaatgttttcagaaaagaacagtctaaaggtgtaaaaacggaaagaagtcatcgtggagtgaaactcaatgaatgtaatcagtgttttaaagtcttcagcacgaaatctaacctaactcagcacaagagaattcatactggagaaaaaccctatgactgtagtcaatgtgggaagtccttcagtagcagatcttaccttactattcataagagaatccataatggggagaaaccctatgaatgcaatcactgtgggaaagcatttagtgatccctcatcccttagactgcatttgagaattcacactggagaaaaaccctatgaatgtaaccagtgttttcacgttttccgcaccagttgtaacctcaaaagccacaagaggattcacacgggggagaatcaccatgaatgtaatcagtgtggaaaagctttcagcacaaggtcctctctcactgggcacaatagcattcatacaggggagaaaccttatgaatgtcacgattgtgggaaaaccttcaggaagagctcctatctgacacagcacgtaagaactcatactggagaaaaaccctatgaatgtaacgagtgtgggaaatccttcagcagtagcttttctcttactgtgcacaagagaatacataccggagagaaaccctacgagtgcagtgactgtggaaaagcctttaataatctctcagctgtgaagaaacacttaagaactcacactggagaaaaaccctatgaatgtaatcattgtgggaaatccttcacaagtaactcctatctttctgtgcacaagagaatacataatagatggatatga
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,971 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 558, mRNA
NCBI Official Synonym Full Names
zinc finger protein 558
NCBI Official Symbol
ZNF558
NCBI Protein Information
zinc finger protein 558
UniProt Protein Name
Zinc finger protein 558
Protein Family
UniProt Gene Name
ZNF558
UniProt Entry Name
ZN558_HUMAN

Uniprot Description

ZNF558: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 19p13.2

Similar Products

Product Notes

The ZNF558 znf558 (Catalog #AAA1273742) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg tcatcctgcc ctcgactgct gctccgtctt ccctgttccc agcctctcag caaaaaggac acacacaggg cggagagctg gttaatgagc tcctgacaag ctggctacgg ggcttggtaa ccttcgagga tgtggccgtg gagttcaccc aggaggagtg ggcgttgctg gaccctgccc aaaggacact gtacagggat gtgatgctgg agaactgcag gaacctggcc tcactagggt gtcgtgttaa taaacccagt ctgatatccc agttggaaca agacaagaag gtggtgacag aggaaagagg aattctacca agcacctgtc cagatttgga gactctactt aaagccaaat ggttaactcc taagaagaat gttttcagaa aagaacagtc taaaggtgta aaaacggaaa gaagtcatcg tggagtgaaa ctcaatgaat gtaatcagtg ttttaaagtc ttcagcacga aatctaacct aactcagcac aagagaattc atactggaga aaaaccctat gactgtagtc aatgtgggaa gtccttcagt agcagatctt accttactat tcataagaga atccataatg gggagaaacc ctatgaatgc aatcactgtg ggaaagcatt tagtgatccc tcatccctta gactgcattt gagaattcac actggagaaa aaccctatga atgtaaccag tgttttcacg ttttccgcac cagttgtaac ctcaaaagcc acaagaggat tcacacgggg gagaatcacc atgaatgtaa tcagtgtgga aaagctttca gcacaaggtc ctctctcact gggcacaata gcattcatac aggggagaaa ccttatgaat gtcacgattg tgggaaaacc ttcaggaaga gctcctatct gacacagcac gtaagaactc atactggaga aaaaccctat gaatgtaacg agtgtgggaa atccttcagc agtagctttt ctcttactgt gcacaagaga atacataccg gagagaaacc ctacgagtgc agtgactgtg gaaaagcctt taataatctc tcagctgtga agaaacactt aagaactcac actggagaaa aaccctatga atgtaatcat tgtgggaaat ccttcacaag taactcctat ctttctgtgc acaagagaat acataataga tggatatga. It is sometimes possible for the material contained within the vial of "ZNF558, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.