RASSF4 cdna clone
RASSF4 cDNA Clone
Gene Names
RASSF4; AD037
Synonyms
RASSF4; RASSF4 cDNA Clone; RASSF4 cdna clone
Sequence
atgaaggaagactgtctgccgagttctcacgtgcccatcagtgacagcaagtccattcagaagtcggagctcttaggcctgctgaaaacctacaactgctaccatgagggcaagagcttccagctgagacaccgtgaggaagaagggactctgatcatcgaggggctcctcaacattgcctgggggctgaggcggcccatccggctgcagatgcaggatgaccgggagcaggtgcacctcccctccacctcatggatgcccagacggcctagctgccctctaaaggagccatcgccccagaacgggaacatcacagcccaggggccaagcattcagccagtgcacaaggctgagagttccacagacagctcggggcccctggaggaggcagaggaggccccccagctgatgcggaccaagagcgacgccagttgcatgagccagaggaggcccaagtgccgcgcccccggtgaggcccagcgcatccggcgacaccggttctctatcaacggccacttctacaatcataagacctccgtgtttactccagcctatggatccgtgaccaatgtgagggtcaacagcaccatgacaaccctgcaggtgctcaccctgctgctgaacaaatttagggtggaagatggccccagtgagttcgcactctacatcgttcacgagtctggggagcggacaaaattaaaagactgcgagtacccgctgatttccagaatcctgcatgggccatgtgagaagatcgccaggatcttcctgatggaagctgacttgggcgtggaagtcccccatgaagtcgctcagtacattaagtttgaaatgccggtgctggacagttttgttgaaaaattaaaagaagaggaagaaagagaaataatcaaactgaccatgaagttccaagccctgcgtctgacgatgctgcagcgcctggagcagctggtggaggccaagtaa
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,735 Da
NCBI Official Full Name
Homo sapiens Ras association (RalGDS/AF-6) domain family member 4, mRNA
NCBI Official Synonym Full Names
Ras association domain family member 4
NCBI Official Symbol
RASSF4
NCBI Official Synonym Symbols
AD037
NCBI Protein Information
ras association domain-containing protein 4
UniProt Protein Name
Ras association domain-containing protein 4
Protein Family
UniProt Gene Name
RASSF4
UniProt Entry Name
RASF4_HUMAN
NCBI Description
The function of this gene has not yet been determined but may involve a role in tumor suppression. Alternative splicing of this gene results in several transcript variants; however, most of the variants have not been fully described. [provided by RefSeq, Jul 2008]
Uniprot Description
RASSF4: Potential tumor suppressor. May act as a KRAS effector protein. May promote apoptosis and cell cycle arrest. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Tumor suppressor
Chromosomal Location of Human Ortholog: 10q11.21
Molecular Function: protein binding
Research Articles on RASSF4
Similar Products
Product Notes
The RASSF4 rassf4 (Catalog #AAA1273735) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaag actgtctgcc gagttctcac gtgcccatca gtgacagcaa gtccattcag aagtcggagc tcttaggcct gctgaaaacc tacaactgct accatgaggg caagagcttc cagctgagac accgtgagga agaagggact ctgatcatcg aggggctcct caacattgcc tgggggctga ggcggcccat ccggctgcag atgcaggatg accgggagca ggtgcacctc ccctccacct catggatgcc cagacggcct agctgccctc taaaggagcc atcgccccag aacgggaaca tcacagccca ggggccaagc attcagccag tgcacaaggc tgagagttcc acagacagct cggggcccct ggaggaggca gaggaggccc cccagctgat gcggaccaag agcgacgcca gttgcatgag ccagaggagg cccaagtgcc gcgcccccgg tgaggcccag cgcatccggc gacaccggtt ctctatcaac ggccacttct acaatcataa gacctccgtg tttactccag cctatggatc cgtgaccaat gtgagggtca acagcaccat gacaaccctg caggtgctca ccctgctgct gaacaaattt agggtggaag atggccccag tgagttcgca ctctacatcg ttcacgagtc tggggagcgg acaaaattaa aagactgcga gtacccgctg atttccagaa tcctgcatgg gccatgtgag aagatcgcca ggatcttcct gatggaagct gacttgggcg tggaagtccc ccatgaagtc gctcagtaca ttaagtttga aatgccggtg ctggacagtt ttgttgaaaa attaaaagaa gaggaagaaa gagaaataat caaactgacc atgaagttcc aagccctgcg tctgacgatg ctgcagcgcc tggagcagct ggtggaggcc aagtaa. It is sometimes possible for the material contained within the vial of "RASSF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
