ZNF580 cdna clone
ZNF580 cDNA Clone
Synonyms
ZNF580; ZNF580 cDNA Clone; ZNF580 cdna clone
Sequence
atgctgctgctgccgccgcggccaccccaccctcggtcctcctctccggaggccatggacccaccgccccccaaggctccccctttccccaaggcggaaggcccctcctccactccttcctcggcggcggggccccgacccccgcggctgggccgccacctcctcatcgacgccaatggggtcccctacacatacacggtgcagctggaggaggagccccggggcccgccccagcgcgaggcgcccccaggagagcccggccctcgcaagggctacagctgcccggagtgcgcccgtgtctttgccagccctctgcggctgcagagccaccgcgtgtcgcactcggacctcaagcccttcacgtgcggcgcctgcggcaaggccttcaagcgctccagccacctgtcgcggcatcgcgccacgcaccgcgcccgcgccgggccgccgcacacctgcccgctctgtccacgccgcttccaggacgccgcggagctggcgcagcacgtgcgcctccactaa
Sequence Length
519
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,756 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 580, mRNA
NCBI Official Synonym Full Names
zinc finger protein 580
NCBI Official Symbol
ZNF580
NCBI Protein Information
zinc finger protein 580
UniProt Protein Name
Zinc finger protein 580
Protein Family
UniProt Gene Name
ZNF580
UniProt Entry Name
ZN580_HUMAN
Uniprot Description
ZNF580: May be involved in transcriptional regulation.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 19q13.42
Cellular Component: nucleus
Molecular Function: protein binding
Biological Process: positive regulation of endothelial cell proliferation; positive regulation of interleukin-8 production; positive regulation of leukocyte chemotaxis
Research Articles on ZNF580
Similar Products
Product Notes
The ZNF580 znf580 (Catalog #AAA1273730) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgc tgccgccgcg gccaccccac cctcggtcct cctctccgga ggccatggac ccaccgcccc ccaaggctcc ccctttcccc aaggcggaag gcccctcctc cactccttcc tcggcggcgg ggccccgacc cccgcggctg ggccgccacc tcctcatcga cgccaatggg gtcccctaca catacacggt gcagctggag gaggagcccc ggggcccgcc ccagcgcgag gcgcccccag gagagcccgg ccctcgcaag ggctacagct gcccggagtg cgcccgtgtc tttgccagcc ctctgcggct gcagagccac cgcgtgtcgc actcggacct caagcccttc acgtgcggcg cctgcggcaa ggccttcaag cgctccagcc acctgtcgcg gcatcgcgcc acgcaccgcg cccgcgccgg gccgccgcac acctgcccgc tctgtccacg ccgcttccag gacgccgcgg agctggcgca gcacgtgcgc ctccactaa. It is sometimes possible for the material contained within the vial of "ZNF580, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
