WDR54 cdna clone
WDR54 cDNA Clone
Synonyms
WDR54; WDR54 cDNA Clone; WDR54 cdna clone
Sequence
atgttccgctgggagcgctccattcccctgcgaggctcggccgccgccctgtgcaacaacctcagtgtgctgcagctgccggctcgcaacctcacgtattttggcgtggttcatggaccaagcgcccagcttctcagcgctgctcctgagggtgtgcccttggcccagcgccagctccacgctaaggagggtgctggagtgagtcccccacttatcactcaggtccactggtgtgtcctccccttccgagtgctgctggtactcacctcacatcgaggaatacagatgtacgagtccaatggctacaccatggtctactggcatgcactggactctggagatgcctccccagtacaggctgtgtttgcccggggaattgctgccagtggccacttcatctgtgtgggaacgtggtcaggccgggtgctggtgtttgacatcccagcaaagggtcccaacattgtactgagcgaggagctggctgggcaccagatgccaatcacagacattgccaccgagcctgcccagggacaggattgtgtggctgacatggtgacggcagatgactcaggcttgctgtgtgtctggcggtcagggccagaattcacattattgacccgcattccaggatttggagttccgtgcccctctgtgcagctgtggcaggggatcatagcagcaggctatgggaacggacaagtgcatctatatgaggccactacaggaaatctacatgtccagatcaatgcccatgcccgggccatctgcgccctggacctggcttctgaggtgggcaagctactctctgcaggtgaggacacctttgtgcatatctggaagctgagcagaaacccagagagtggctacattgaggtggaacactgtcatggtgagtgtgtcgccgacacccagctgtgtggtgctcgattttgtgattcctcaggcaactcctttgctgtgactggctatgaccttgcggagatccggagattcagcagtgtgtga
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,891 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 54, mRNA
NCBI Official Synonym Full Names
WD repeat domain 54
NCBI Official Symbol
WDR54
NCBI Protein Information
WD repeat-containing protein 54
UniProt Protein Name
WD repeat-containing protein 54
Protein Family
UniProt Gene Name
WDR54
UniProt Entry Name
WDR54_HUMAN
Uniprot Description
WDR54: a WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. Two alternatively spliced human isoforms have been described.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 2p13.1
Similar Products
Product Notes
The WDR54 wdr54 (Catalog #AAA1273667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccgct gggagcgctc cattcccctg cgaggctcgg ccgccgccct gtgcaacaac ctcagtgtgc tgcagctgcc ggctcgcaac ctcacgtatt ttggcgtggt tcatggacca agcgcccagc ttctcagcgc tgctcctgag ggtgtgccct tggcccagcg ccagctccac gctaaggagg gtgctggagt gagtccccca cttatcactc aggtccactg gtgtgtcctc cccttccgag tgctgctggt actcacctca catcgaggaa tacagatgta cgagtccaat ggctacacca tggtctactg gcatgcactg gactctggag atgcctcccc agtacaggct gtgtttgccc ggggaattgc tgccagtggc cacttcatct gtgtgggaac gtggtcaggc cgggtgctgg tgtttgacat cccagcaaag ggtcccaaca ttgtactgag cgaggagctg gctgggcacc agatgccaat cacagacatt gccaccgagc ctgcccaggg acaggattgt gtggctgaca tggtgacggc agatgactca ggcttgctgt gtgtctggcg gtcagggcca gaattcacat tattgacccg cattccagga tttggagttc cgtgcccctc tgtgcagctg tggcagggga tcatagcagc aggctatggg aacggacaag tgcatctata tgaggccact acaggaaatc tacatgtcca gatcaatgcc catgcccggg ccatctgcgc cctggacctg gcttctgagg tgggcaagct actctctgca ggtgaggaca cctttgtgca tatctggaag ctgagcagaa acccagagag tggctacatt gaggtggaac actgtcatgg tgagtgtgtc gccgacaccc agctgtgtgg tgctcgattt tgtgattcct caggcaactc ctttgctgtg actggctatg accttgcgga gatccggaga ttcagcagtg tgtga. It is sometimes possible for the material contained within the vial of "WDR54, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
