GPR17 cdna clone
GPR17 cDNA Clone
Synonyms
GPR17; GPR17 cDNA Clone; GPR17 cdna clone
Sequence
atgaatggccttgaagtggctcccccaggtctgatcaccaacttctccctggccacggcagagcaatgtggccaggagacgccactggagaacatgctgttcgcctccttctaccttctagattttatcctggctttagttggcaataccctggctctgtggtttttcatccgagaccacaagtccgggaccccggccaacgtgttcctgatgcatctggccgtggccgacttgtcgtgcgtgctggtcctgcccacccgcctggtctaccacttctctgggaaccactggccatttggggaaatcgcatgccgtctcaccggcttcctcttctacctcaacatgtacgccagcatctacttcctcacctgcatcagcgccgaccgtttcctggccattgtgcacccggtcaagtccctcaagctccgcaggcccctctacgcacacctggcctgtgccttcctgtgggtggtggtggctgtggccatggccccgctgctggtgagcccacagaccgtgcagaccaaccacacggtggtctgcctgcagctgtaccgggagaaggcctcccaccatgccctggtgtccctggcagtggccttcaccttcccgttcatcaccacggtcacctgctacctgctgatcatccgcagcctgcggcagggcctgcgtgtggagaagcgcctcaagaccaaggcagtgcgcatgatcgccatagtgctggccatcttcctggtctgcttcgtgccctaccacgtcaaccgctccgtctacgtgctgcactaccgcagccatggggcctcctgcgccacccagcgcatcctggccctggcaaaccgcatcacctcctgcctcaccagcctcaacggggcactcgaccccatcatgtatttcttcgtggctgagaagttccgccacgccctgtgcaacttgctctgtggcaaaaggctcaagggcccgccccccagcttcgaagggaaaaccaacgagagctcgctgagtgccaagtcagagctgtga
Sequence Length
1020
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,827 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 17, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 17
NCBI Official Symbol
GPR17
NCBI Protein Information
uracil nucleotide/cysteinyl leukotriene receptor
UniProt Protein Name
Uracil nucleotide/cysteinyl leukotriene receptor
Protein Family
UniProt Gene Name
GPR17
UniProt Synonym Gene Names
UDP/CysLT receptor
UniProt Entry Name
GPR17_HUMAN
Uniprot Description
GPR17: Dual specificity receptor for uracil nucleotides and cysteinyl leukotrienes (CysLTs). Signals through G(i) and inhibition of adenylyl cyclase. May mediate brain damage by nucleotides and CysLTs following ischemia. Belongs to the G-protein coupled receptor 1 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; GPCR, family 1; Receptor, GPCR; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 2q21
Cellular Component: integral to plasma membrane; plasma membrane
Molecular Function: chemokine receptor activity
Research Articles on GPR17
Similar Products
Product Notes
The GPR17 gpr17 (Catalog #AAA1273665) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatggcc ttgaagtggc tcccccaggt ctgatcacca acttctccct ggccacggca gagcaatgtg gccaggagac gccactggag aacatgctgt tcgcctcctt ctaccttcta gattttatcc tggctttagt tggcaatacc ctggctctgt ggtttttcat ccgagaccac aagtccggga ccccggccaa cgtgttcctg atgcatctgg ccgtggccga cttgtcgtgc gtgctggtcc tgcccacccg cctggtctac cacttctctg ggaaccactg gccatttggg gaaatcgcat gccgtctcac cggcttcctc ttctacctca acatgtacgc cagcatctac ttcctcacct gcatcagcgc cgaccgtttc ctggccattg tgcacccggt caagtccctc aagctccgca ggcccctcta cgcacacctg gcctgtgcct tcctgtgggt ggtggtggct gtggccatgg ccccgctgct ggtgagccca cagaccgtgc agaccaacca cacggtggtc tgcctgcagc tgtaccggga gaaggcctcc caccatgccc tggtgtccct ggcagtggcc ttcaccttcc cgttcatcac cacggtcacc tgctacctgc tgatcatccg cagcctgcgg cagggcctgc gtgtggagaa gcgcctcaag accaaggcag tgcgcatgat cgccatagtg ctggccatct tcctggtctg cttcgtgccc taccacgtca accgctccgt ctacgtgctg cactaccgca gccatggggc ctcctgcgcc acccagcgca tcctggccct ggcaaaccgc atcacctcct gcctcaccag cctcaacggg gcactcgacc ccatcatgta tttcttcgtg gctgagaagt tccgccacgc cctgtgcaac ttgctctgtg gcaaaaggct caagggcccg ccccccagct tcgaagggaa aaccaacgag agctcgctga gtgccaagtc agagctgtga. It is sometimes possible for the material contained within the vial of "GPR17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
