Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRC1 cdna clone

PRC1 cDNA Clone

Gene Names
PRC1; ASE1
Synonyms
PRC1; PRC1 cDNA Clone; PRC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggagaagtgaggtgctggcggaggagtccatagtatgtctgcagaaagccctaaatcaccttcgggaaatatgggagctaattgggattccagaggaccagcggttacaaagaactgaggtggtaaagaagcatatcaaggaactcctggatatgatgattgctgaagaggaaagcctgaaggaaagactcatcaaaagcatatccgtctgtcagaaagagctgaacactctgtgcagcgagttacatgttgagccatttcaggaagaaggagagacaaccatcttgcaactagaaaaagatttgcgcacccaagtggaattgatgcgaaaacagaaaaaggagagaaaacaggaactgaagctacttcaagagcaagatcaagaactgtgcgaaattctttgtatgccccactatgatattgacagtgcctcagtgcccagcttagaagaactgaaccagttcaggcaacatgtgacaactttgagggaaacaaaggcttctaggcgtgaggagtttgtcagtataaagagacagatcatactgtgtatggaagaattagaccacaccccagacacaagctttgaaagagatgtggtgtgtgaagacgaagatgccttttgtttgtctttggagaatattgcaacactacaaaagttgctacggcagctggaaatgcagaaatcacaaaatgaagcagtgtgtgaggggctgcgtactcaaatccgagagctctgggacaggttgcaaatacctgaagaagaaagagaagctgtggccaccattatgtctgggtcaaaggccaaggtccggaaagcgctgcaattagaagtggatcggttggaagaactgaaaatgcaaaacatgaagaaagtgattgaggcaattcgagtggagctggttcagtactgggaccagtgcttttatagccaggagcagagacaagcttttgcccctttctgtgctgaggactacacagaaagtctgctccagctccacgatgctgagattgtgcggttaaaaaactactatgaagttcacaaggaactctttgaaggtgtccagaagtgggaagaaacctggaggcttttcttagagtttgagagaaaagcttcagatccaaatcgatttacaaaccgaggaggaaatcttctaaaagaagaaaaacaacgagccaagctccagaaattcatggagtatgtggcagaacaatgggagatgcatcgattggagaaagagagagccaagcaggaaagacaactgaagaacaaaaaacagacagagacagagatgctgtatggcagcgctcctcgaacacctagcaagcggcgaggactggctcccaatacaccgggcaaagcacgtaagctgaacactaccaccatgtccaatgctacggccaatagtagcattcggcctatctttggagggacagtctaccactcccccgtgtctcgacttcctccttctggcagcaagccagtcgctgcttccacctgttcagggaagaaaacaccccgtactggcaggcatggagccaacaaggagaacctggagctcaacggcagcatcctgagtggtgggtaccctggctcggcccccctccagcgcaacttcagcattaattctgttgccagcacctattctgagtttgcgcgagaactttcaaaggcttccaaatctgatgctacttctggaatcctcaattcaaccaacatccagtcctga
Sequence Length
1731
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,191 Da
NCBI Official Full Name
Homo sapiens protein regulator of cytokinesis 1, mRNA
NCBI Official Synonym Full Names
protein regulator of cytokinesis 1
NCBI Official Symbol
PRC1
NCBI Official Synonym Symbols
ASE1
NCBI Protein Information
protein regulator of cytokinesis 1
UniProt Protein Name
Protein regulator of cytokinesis 1
UniProt Gene Name
PRC1
UniProt Entry Name
PRC1_HUMAN

NCBI Description

This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]

Uniprot Description

PRC1: translocates to the plus ends of interdigitating spindle microtubules during the metaphase to anaphase transition, an essential step for the formation of an organized central spindle midzone and midbody and for successful cytokinesis. Acts as a microtubule-binding and bundling protein both in vivo and vitro. Interacts with the C-terminal Rho-GAP domain and the basic region of MgcRacGAP. The interaction with MgcRacGAP inhibits its GAP activity towards CDC42 in vitro, which may be required for maintaining normal spindle morphology. Interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal; Cell cycle regulation; Microtubule-binding

Chromosomal Location of Human Ortholog: 15q26.1

Cellular Component: cytoplasm; cytosol; microtubule cytoskeleton; midbody; nucleoplasm; nucleus; plasma membrane; spindle; spindle microtubule

Molecular Function: kinesin binding; protein binding; protein kinase binding

Biological Process: cytokinesis; mitotic spindle elongation; positive regulation of cell proliferation

Research Articles on PRC1

Similar Products

Product Notes

The PRC1 prc1 (Catalog #AAA1273608) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggagaa gtgaggtgct ggcggaggag tccatagtat gtctgcagaa agccctaaat caccttcggg aaatatggga gctaattggg attccagagg accagcggtt acaaagaact gaggtggtaa agaagcatat caaggaactc ctggatatga tgattgctga agaggaaagc ctgaaggaaa gactcatcaa aagcatatcc gtctgtcaga aagagctgaa cactctgtgc agcgagttac atgttgagcc atttcaggaa gaaggagaga caaccatctt gcaactagaa aaagatttgc gcacccaagt ggaattgatg cgaaaacaga aaaaggagag aaaacaggaa ctgaagctac ttcaagagca agatcaagaa ctgtgcgaaa ttctttgtat gccccactat gatattgaca gtgcctcagt gcccagctta gaagaactga accagttcag gcaacatgtg acaactttga gggaaacaaa ggcttctagg cgtgaggagt ttgtcagtat aaagagacag atcatactgt gtatggaaga attagaccac accccagaca caagctttga aagagatgtg gtgtgtgaag acgaagatgc cttttgtttg tctttggaga atattgcaac actacaaaag ttgctacggc agctggaaat gcagaaatca caaaatgaag cagtgtgtga ggggctgcgt actcaaatcc gagagctctg ggacaggttg caaatacctg aagaagaaag agaagctgtg gccaccatta tgtctgggtc aaaggccaag gtccggaaag cgctgcaatt agaagtggat cggttggaag aactgaaaat gcaaaacatg aagaaagtga ttgaggcaat tcgagtggag ctggttcagt actgggacca gtgcttttat agccaggagc agagacaagc ttttgcccct ttctgtgctg aggactacac agaaagtctg ctccagctcc acgatgctga gattgtgcgg ttaaaaaact actatgaagt tcacaaggaa ctctttgaag gtgtccagaa gtgggaagaa acctggaggc ttttcttaga gtttgagaga aaagcttcag atccaaatcg atttacaaac cgaggaggaa atcttctaaa agaagaaaaa caacgagcca agctccagaa attcatggag tatgtggcag aacaatggga gatgcatcga ttggagaaag agagagccaa gcaggaaaga caactgaaga acaaaaaaca gacagagaca gagatgctgt atggcagcgc tcctcgaaca cctagcaagc ggcgaggact ggctcccaat acaccgggca aagcacgtaa gctgaacact accaccatgt ccaatgctac ggccaatagt agcattcggc ctatctttgg agggacagtc taccactccc ccgtgtctcg acttcctcct tctggcagca agccagtcgc tgcttccacc tgttcaggga agaaaacacc ccgtactggc aggcatggag ccaacaagga gaacctggag ctcaacggca gcatcctgag tggtgggtac cctggctcgg cccccctcca gcgcaacttc agcattaatt ctgttgccag cacctattct gagtttgcgc gagaactttc aaaggcttcc aaatctgatg ctacttctgg aatcctcaat tcaaccaaca tccagtcctg a. It is sometimes possible for the material contained within the vial of "PRC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.