Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

CRCP cdna clone

CRCP cDNA Clone

Gene Names
CRCP; RCP; RCP9; CGRPRCP; CGRP-RCP
Synonyms
CRCP; CRCP cDNA Clone; CRCP cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggaagtgaaggatgccaattctgcgcttctcagtaactacgagacgttaaaatacatatcaaaaacaccatgcaggcaccagagtcctgaaattgtcagagaatttctcacagcattgaaaagccacaagttgaccaaagctgagaagctccagctgctgaaccaccggcctgtgactgctgtggagatccagctgatggtggaagagagtgaagagcggctcacggaggagcagattgaagctcttctccacaccgtcaccagcattctgcctgcagagccagaggctgagcagaagaagaatacaaacagcaatgtggcaatggacgaagaggacccagcatag
Sequence Length
348
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,011 Da
NCBI Official Full Name
Homo sapiens CGRP receptor component, mRNA
NCBI Official Synonym Full Names
CGRP receptor component
NCBI Official Symbol
CRCP
NCBI Official Synonym Symbols
RCP; RCP9; CGRPRCP; CGRP-RCP
NCBI Protein Information
DNA-directed RNA polymerase III subunit RPC9
UniProt Protein Name
DNA-directed RNA polymerase III subunit RPC9
UniProt Gene Name
CRCP
UniProt Synonym Gene Names
RNA polymerase III subunit C9; CGRP-RCP; CGRP-receptor component protein; CGRPRCP; HsC17
UniProt Entry Name
RPC9_HUMAN

NCBI Description

This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

CGRP-RCP: an ubiquitous coupling protein for the calcitonin gene-related peptide (CGRP) and adrenomedullin receptors. Modulates ligand responsiveness in a variety of tissues. Two splice-variant isoforms have been described.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 7q11.21

Cellular Component: cytosol; DNA-directed RNA polymerase III complex; nucleoplasm

Molecular Function: DNA-directed RNA polymerase activity; protein binding

Biological Process: positive regulation of interferon type I production; transcription from RNA polymerase III promoter; transcription initiation from RNA polymerase III promoter

Research Articles on CRCP

Similar Products

Product Notes

The CRCP crcp (Catalog #AAA1273595) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagtga aggatgccaa ttctgcgctt ctcagtaact acgagacgtt aaaatacata tcaaaaacac catgcaggca ccagagtcct gaaattgtca gagaatttct cacagcattg aaaagccaca agttgaccaa agctgagaag ctccagctgc tgaaccaccg gcctgtgact gctgtggaga tccagctgat ggtggaagag agtgaagagc ggctcacgga ggagcagatt gaagctcttc tccacaccgt caccagcatt ctgcctgcag agccagaggc tgagcagaag aagaatacaa acagcaatgt ggcaatggac gaagaggacc cagcatag. It is sometimes possible for the material contained within the vial of "CRCP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual