Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD27 cdna clone

CD27 cDNA Clone

Gene Names
CD27; T14; S152; Tp55; TNFRSF7; S152. LPFS2
Synonyms
CD27; CD27 cDNA Clone; CD27 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacggccacatccctggtggctgtgcgttctggggaccctggtggggctctcagctactccagcccccaagagctgcccagagaggcactactgggctcagggaaagctgtgctgccagatgtgtgagccaggaacattcctcgtgaaggactgtgaccagcatagaaaggctgctcagtgtgatccttgcataccgggggtctccttctctcctgaccaccacacccggccccactgtgagagctgtcggcactgtaactctggtcttctcgttcgcaactgcaccatcactgccaatgctgagtgtgcctgtcgcaatggctggcagtgcagggacaaggagtgcaccgagtgtgatcctcttccaaacccttcgctgaccgctcggtcgtctcaggccctgagcccacaccctcagcccacccacttaccttatgtcagtgagatgctggaggccaggacagctgggcacatgcagactctggctgacttcaggcagctgcctgcccggactctctctacccactggccaccccaaagatccctgtgcagctccgattttattcgcatccttgtgatcttctctggaatgttccttgttttcaccctggccggggccctgttcctccatcaacgaaggaaatatagatcaaacaaaggagaaagtcctgtggagcctgcagagccttgtcgttacagctgccccagggaggaggagggcagcaccatccccatccaggaggattaccgaaaaccggagcctgcctgctccccctga
Sequence Length
783
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
939
Molecular Weight
29,137 Da
NCBI Official Full Name
Homo sapiens CD27 molecule, mRNA
NCBI Official Synonym Full Names
CD27 molecule
NCBI Official Symbol
CD27
NCBI Official Synonym Symbols
T14; S152; Tp55; TNFRSF7; S152. LPFS2
NCBI Protein Information
CD27 antigen
UniProt Protein Name
CD27 antigen
Protein Family
UniProt Gene Name
CD27
UniProt Synonym Gene Names
TNFRSF7
UniProt Entry Name
CD27_HUMAN

NCBI Description

The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. [provided by RefSeq, Jul 2008]

Uniprot Description

CD27: Receptor for CD70/CD27L. May play a role in survival of activated T-cells. May play a role in apoptosis through association with SIVA1.

Protein type: Receptor, cytokine; Membrane protein, integral; Apoptosis

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: integral to plasma membrane; neuron projection; nucleus; plasma membrane

Molecular Function: caspase inhibitor activity; protein binding; tumor necrosis factor receptor activity

Biological Process: brain development; immune response; induction of apoptosis via death domain receptors; inflammatory response; negative regulation of apoptosis; positive regulation of JNK cascade; positive regulation of MAPKKK cascade; regulation of cell proliferation; response to lipopolysaccharide; tumor necrosis factor-mediated signaling pathway

Disease: Lymphoproliferative Syndrome 2

Research Articles on CD27

Similar Products

Product Notes

The CD27 cd27 (Catalog #AAA1273588) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacggc cacatccctg gtggctgtgc gttctgggga ccctggtggg gctctcagct actccagccc ccaagagctg cccagagagg cactactggg ctcagggaaa gctgtgctgc cagatgtgtg agccaggaac attcctcgtg aaggactgtg accagcatag aaaggctgct cagtgtgatc cttgcatacc gggggtctcc ttctctcctg accaccacac ccggccccac tgtgagagct gtcggcactg taactctggt cttctcgttc gcaactgcac catcactgcc aatgctgagt gtgcctgtcg caatggctgg cagtgcaggg acaaggagtg caccgagtgt gatcctcttc caaacccttc gctgaccgct cggtcgtctc aggccctgag cccacaccct cagcccaccc acttacctta tgtcagtgag atgctggagg ccaggacagc tgggcacatg cagactctgg ctgacttcag gcagctgcct gcccggactc tctctaccca ctggccaccc caaagatccc tgtgcagctc cgattttatt cgcatccttg tgatcttctc tggaatgttc cttgttttca ccctggccgg ggccctgttc ctccatcaac gaaggaaata tagatcaaac aaaggagaaa gtcctgtgga gcctgcagag ccttgtcgtt acagctgccc cagggaggag gagggcagca ccatccccat ccaggaggat taccgaaaac cggagcctgc ctgctccccc tga. It is sometimes possible for the material contained within the vial of "CD27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.