Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACOT6 cdna clone

ACOT6 cDNA Clone

Gene Names
ACOT6; C14orf42; c14_5530
Synonyms
ACOT6; ACOT6 cDNA Clone; ACOT6 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcagcatccaaaggtgaaaggtcctagtattgcgcttcttggattttccaaaggaggtgacctgtgtctctcaatggcttctttcttgaagggcatcacagccactgtacttatcaatgcctgtgtagccaacacagtagctcctctacattacaaggatatgattattcctaaacttgtcgatgatctaggaaaagtaaaaatcactaagtcaggatttctcacttttatggacacttggagcaatccactggaggaacacaatcaccaaagtcttgttccattggaaaaggcgcaggtgcccttcttgtttattgttggcatggatgatcaaagctggaagagtgaattctatgctcagatagcctctgaaaggctacaagctcatgggaaagaaagaccccagataatctgttacccagaaactggtcactgtattgacccaccttattttcctccttctagagcttctgtgcacgctgttttgggtgaggcaatattctatggaggtgagccaaaggctcactcaaaggcacaggtagatgcctggcagcaaattcaaactttcttccataaacatctcaatggtaaaaaatctgtcaagcacagcaaaatataa
Sequence Length
624
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,991 Da
NCBI Official Full Name
Homo sapiens acyl-CoA thioesterase 6, mRNA
NCBI Official Synonym Full Names
acyl-CoA thioesterase 6
NCBI Official Symbol
ACOT6
NCBI Official Synonym Symbols
C14orf42; c14_5530
NCBI Protein Information
putative acyl-coenzyme A thioesterase 6
UniProt Protein Name
Putative acyl-coenzyme A thioesterase 6
UniProt Gene Name
ACOT6
UniProt Synonym Gene Names
C14orf42; Putative acyl-CoA thioesterase 6
UniProt Entry Name
ACOT6_HUMAN

Uniprot Description

ACOT6: Belongs to the C/M/P thioester hydrolase family.

Protein type: Hydrolase; EC 3.1.2.-

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cytosol; peroxisomal matrix

Molecular Function: acyl-CoA hydrolase activity

Similar Products

Product Notes

The ACOT6 acot6 (Catalog #AAA1273553) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcagc atccaaaggt gaaaggtcct agtattgcgc ttcttggatt ttccaaagga ggtgacctgt gtctctcaat ggcttctttc ttgaagggca tcacagccac tgtacttatc aatgcctgtg tagccaacac agtagctcct ctacattaca aggatatgat tattcctaaa cttgtcgatg atctaggaaa agtaaaaatc actaagtcag gatttctcac ttttatggac acttggagca atccactgga ggaacacaat caccaaagtc ttgttccatt ggaaaaggcg caggtgccct tcttgtttat tgttggcatg gatgatcaaa gctggaagag tgaattctat gctcagatag cctctgaaag gctacaagct catgggaaag aaagacccca gataatctgt tacccagaaa ctggtcactg tattgaccca ccttattttc ctccttctag agcttctgtg cacgctgttt tgggtgaggc aatattctat ggaggtgagc caaaggctca ctcaaaggca caggtagatg cctggcagca aattcaaact ttcttccata aacatctcaa tggtaaaaaa tctgtcaagc acagcaaaat ataa. It is sometimes possible for the material contained within the vial of "ACOT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.